For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 99 bp
Wild Type =116 bp
>chr17:36950289-36950404 116bp AAATAGCTATACCATGTTGCA GGCCTTTGATCTCACTTTCT
Sequence
Wt Sequence (deletion in lower case):
TTGTTGTTGTTTTTGTTCCCGTGGATACAAGGGATCAAACTCAGGTCTTCATGCTTGCACCAAAAGAGCTTTACCAACAGAGATGTCTCCCCATCCCTGCTTTATTTTATTTTATTTTTTTCTGAGAAAATAGCTATACCATGTTGCAGAGGCCATTTCAgtctcccaagtgctgagattacatacctcagtctctttagaacatgaataagaggtgtgaagaagaaagtgagatcaaaggccagtcacaggaaagggagaaaataacattcatatattaatgccaccaagggtgatagcgttggttgtatcttagtttgccaatttgctggcaccttccctagtttaagaattgccttctttgcatactattggttatcaagaacagggattcatactctccacaaacaggctgtcctgcctctccaggggcatgatgtgtgttactgactgagccagggaagagaaaaaaggaggttccataggaaacaggaaaaatcaagaggaagtgagtcagatgggcccacacctcttttaacttttcaggagaatcagagcctaactatgaaacttcggaaacgcaagccagagaagaaggtggagtggtccagtgacactgtggacaatgagcatatggggcgacgctcgtcgaaatgtgagtgtgggtggcccagtgtccctggccaccatctcactgttgctttatagctctatcgagttcttggttggaaagaaaaataggtgggaataaaactatgcGGTACCAACTGCCTGGAGTTAGGGGTGGGGGCGGGGGCAAGCCATGGCAGAATGGGAGTCAGGTTTTTCCGACTCTCTCTTGAATTCCTGGGGGAAGAGGCTAAGGCAGCTGGATTCCAGAAAAGTAGGGAGAGGTTTTCACACAGATCTG
This mutation is a 599 bp deletion beginning at Chromosome 17 position 37,260,665 bp and ending after 37,261,263 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68924 | AAA CCT GAC TCC CAT TCT G | Common | A | |||
| 68925 | AAA TAG CTA TAC CAT GTT GCA | Mutant Forward | A | |||
| 70005 | GGC CTT TGA TCT CAC TTT CT | Wild type Reverse | A | |||
| 70006 | Fluorophore-1 | TCT CCC AAG TGC TGA GAT TA | Quencher-1 | WT Probe | ||
| 70007 | Fluorophore-2 | AGG CCA TTT CAG GTA CCA ACT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68924 | 0.40 uM |
| 68925 | 0.40 uM |
| 70005 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.