For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 92 bp
Wild Type = 98 bp
>chr18:51302574+51302671 98bp TGCTCTTCAACACAATTACC CTGTCGGTCATCTCATCTTC
Sequence
Wt Sequence (deletion in lower case; insertions with carrots ^g^ (g insertion):
CAGTCAGGGCTTTTGTAGAAGCTCAAAGCTGATCAGAAAAGGTATGCTTTTAATTGTGTTTTACTTCCGGTTGCTCTTCAACACAATTACCTTGTCCTTTCCACCAGGTGGTTGACCAGATTGACACCCTGA^g^cctctgatctacagctggaagatgagatgaccgacagctccaaaacagacactctgaacagcagctccagtgggacaacagcctccagcatagagaagatcaaagaacaggccaatgctcccctcattaaacctccagcacacccgtctgctatcctgactgtcctgagaaagccaaaccctccaccgcctcctccaaggttgacacccgtgaggtgtgaagagcctcagagagtggtgccgactgccaaccctgtaaagaccaatggcacccttctgcggaatggaggcttagcggggaggcccaacaaaattccaaatggagacatctgctgcatacccaacagtaacttggacaaggctccgttgcagtctctgatgcacagacctgaaaaggacaggagtcctcaggcagggcctcgggaacgagttcggtttaatgaaaaagtacaataccatggctattgtcctgactgtgagagccggtataacataaagaatagggaggtccatttacacagtgaaccagtccatccacctggaaagatcccacaccaaggacctctgctccatcctccacctcatctccccaatttcccattagaaaatgggggactgggaataagccacagtaacagtttcccccctcccacacctgcaaccgtgcctcctcccgctgcaccaaaaccacagaagaccatcctgaggaAATCCACCACTACCACAGTGTGATATCTGCCATTTAAGAAAACGTTCTGTTTGTTTTTAATTTTCTATATGATAAACGTAAAATAATAAGTAATGAGCACTTTCTACTCAAGCAATAAAAAGCCCAAATATATTAATCTGCATTCAACAAAGTGGCATAAAAAATCACGTGGTAAGTATGCAGAGTAGCGCCTCTGTCCT
This mutation is a a 708 bp deletion beginning at Chromosome 18 position 51,302,635 bp and ending after 51,303,342 bp (GRCm38/mm10). There is a 1 bp insertion (G) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68664 | TGC TCT TCA ACA CAA TTA CC | Common | A | |||
| 68665 | CTG TCG GTC ATC TCA TCT TC | Wild type Reverse | A | |||
| 68666 | GCA GAT ATC ACA CTG TGG TA | Mutant Reverse | A | |||
| 68667 | Fluorophore-1 | CAC CCT GAC CTC TGA TCT AC | Quencher-1 | WT Probe | ||
| 68668 | Fluorophore-2 | TGA CAC CCT GAG AAT CCA CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68664 | 0.40 uM |
| 68665 | 0.40 uM |
| 68666 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.