For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 82 bp
Wild Type = 119 bp
>chr13:68583528+68583646 119bp CTTATGCTAAGTCACATGTTGT GGTGAATTTTCAGAGCAACC
Sequence
Wt Sequence (deletion in lower case):
CAGGACCAGGAGAGTGGGGACCCCCTTCCCAGGCTTTCTCTTGTTTCCTGGCTCGGTGGGAAAAGTAAACCTTGGTTTTTAAAATATTTTTGCAAGGTTCTTTTTTTTTTTTAATCTTTGTCATGGGATACTCATTCTTAGTTTCGTAGCGTTGGTGTTGTCTTTCTCAGCATTTGACCATGGTTTTTGTTTTTGTTTTTCTTATGCTAAGTCACATGTTGTGAATTCTATGGCATGGCGttcatcaccctgcggagggccttttgtcataagtccattctttggatacctggagctgtggttgctctgaaaattcaccctgccagtcatgccccaaaggcagtcacagatcgcctgagtgtgtgcttctgctccctacaacctgagctgttcagggtcagattccatcacgcatactgtaaaaacttccactcagaaaagggaaatgactttcatcccgtgggcgagccatggtcctcccaggcgcaggaatggaaccagccaggacagagtcttcaaaacgaggatgaagagatgcttttcaggagactaagctacttcacttcctttgaggaagtgctgagtttcataagtgccctggacaccctgcctgtccctctggcaatggcagctctactcaggatctgtgagatagggaggagggatggtgagcaaaggctgccagaaggagtgctggagaaccgtgccttccaggctctttgcctccggtgtgagcgagacccctcacacctgaccaatgctggtttggtgacagctttgcaatctctgcttacgttgttgcctgcagatcctcaaagtagcctgatgctgagcctggtggcagaatgccaacgtcgtctccaaagaggcaacctcgaagtccaccatctttgtgtccttggggaaagtctggccatgcttcaaggtgcgagttgtgagaccctgaagctggttgtccgtcaacttcaaagtaaaagtgtggaaacatttgctccagaggagatcacgtccgtttataggattctgcaggtgtgtcctgaagaagtagacaaacaccagatgttcttaaacacattaaacaacttctccatttcagtagttccctacctgagccctaaatccattagccatgtcctcaccgccttagtggccctggaccagactcacgcactcccactgcttataaagctgggcaagtacgttgtgagatacatcccccgttttaccaacgaagagctcaggaaggtcttggaggcgtttgtctatttcggacacagtgacaggttcttcacagaggccttagagcaacatgtgtccgccctgtgcttctccctggaccccgctgtggccagctccgtgatggggtactgcagcaggaaacggattctctccaagcccatcttcgacgtagtctcagagatcgttgtttgccagtgggacagactttcacctagtcagattgccgagctaattgagccatttggaaagctcaattacgtgccaccaaacgcccctgccctgtttaggaaggtagaaaatgtgctctgtgcccgtttacatcacttcccaccaaagatgctactgaggctccttcattcatgtgcgctgattgagcgacatcccgtcaacttcatgtcaaaactattcagcccctttttccttcagcggctGCAAGGTGAGGCGGTTAAGAAGTGATGTATAACTTGGGATGTGGTCAGGCACTGCTTACACTGAGAGCTCCAGTGTCGTTTCAGACTGCTTGCTCCGGAAGTAGCTGGGTGGTTTTATAATTATAATCCCTCATTTACATGCCAACATTC
This mutation is a 1430 bp deletion beginning at Chromosome 13 position 68,583,568 bp and ending after 68,584,997 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68654 | CTT ATG CTA AGT CAC ATG TTG T | Common | A | |||
| 68655 | GGT GAA TTT TCA GAG CAA CC | Wild type Reverse | A | |||
| 68656 | ACA TCC CAA GTT ATA CAT CAC T | Mutant Reverse | A | |||
| 68657 | Fluorophore-1 | GGC CTT TTG TCA TAA GTC CA | Quencher-1 | WT Probe | ||
| 68658 | Fluorophore-2 | GCA AGG TGA GGC GGT TAA GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68654 | 0.40 uM |
| 68655 | 0.40 uM |
| 68656 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.