For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr15:44400035+44400183 149bp ATTGTCCATGTGCTGCCTTC GTAACGGTCAGGCTTCCAGA
Mutant= 107 bp
Wild Type = 149 bp
Sequence
Wt Sequence (deletions in lower case):
ATGAAGGGGAGGGGTAGAGAGAGGCAGAAAGTGAAGTAACAAAGGAAGAGATTGCTGTCAATATTttggggtgccagtctcttaatgcattttgtggacctggaaaagaggaaaatatgtgtatttgttacaattccttgtgtcgattccttgaagtcttgtgtgtttataatttgtgtatatgtgagagaaatgatctctagacaatattgatttggataggtgttctcttagatgtctagctatactatcctatgttgtgtctaatttttattgctacataatgccttttcctattcccagtagaacctctgtattactggcaacaaagtgaggatgatttgacagtaacggtcaggcttccagaaagcagtactaaggaagatattcaaatacaatttttgcctgataatatcaacattaagctgaaggatatccaagttttggaaggaaaactctattcatctattgatcacgaaggcagcacatggacaattaaagagaatgataggtatttttgtagttttactttagaaaatttatttcttatgacttcacattttccttctgatctctctacaagtaggtacattgaaggtgaatataatagtttcatctatatcgatttttcagacagattaaagatggtgaaactacattaaaatgtaattgtagttaagattgatgctgctatacttactgtttttcatgaccagctctatatacagagataATAAAAGGTGAAACTATTTACTTATTTTCATTCGTACTCTTAAAACATTGCAGTAGAAATA
This mutation is a 668 bp deletion beginning at Chromosome 15 position 44,399,798 bp and ending after 44,400,465 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65336 | ATT GTC CAT GTG CTG CCT TC | Wild type Forward | A | |||
| 67379 | CTG CAA TGT TTT AAG AGT ACG AAT G | Mutant Forward | A | |||
| 67380 | GGG TAG AGA GAG GCA GAA AGT GA | Mutant Reverse | A | |||
| 67381 | GTA ACG GTC AGG CTT CCA GA | Wild type Reverse | A | |||
| 67382 | Fluorophore-1 | AGT AAC AAA GGA AGA GAT TGC TGT CAA | Quencher-1 | MUT Probe | ||
| 67383 | Fluorophore-2 | TGC CTG ATA ATA TCA ACA TTA AGC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65336 | 0.40 uM |
| 67379 | 0.40 uM |
| 67380 | 0.40 uM |
| 67381 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.