For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr14:36938618-36938733 116bp CCGGATACGGATTACAGAGC ACAGGATGGACACTCCCAAT
Mutant= 96 bp
Wild Type = 116 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AAAAGTTTATTTAGTATTTAGGAAAATGCTACAGTTATAGTTTTTGAACCAAATGCTGttataatagattggattattagagcttatattttagaaatgagaaatgactgtgttttataaattcacgcttttttctttcttttaaaatcatttgaagacaggagtgaatgtacaaagcatacatctggaaacaacttgatttcaccggatacggattacagagctgggtcttcatttgaactctctccgtccgatagctctgatggaacgtacatgtgggatgaagagggcctggagcccattgggagtgtccatcctgttggcagctatgagtcctctgaaatgaacagcatagtatgtatggatttctctaccctttgggagatttctttttatttctttatacaaacacatacaaatacacacatacataatttattataaaggcattagtgtattggttaagttaagctaagaacgtgacatctacaacacttttagttgctgtattgagaagtgccccTTGGTGAAGGGGTGTCAGGGATGGTGCTTAACATGCGCTTCCTACAGAAAGAGTGGTGGACTGATGGACCAGTTGATCCAGGACCAAGTATCTGGGTAGGCTGTGCTGATGGA
This mutation is a 465 bp deletion beginning at Chromosome 14 position 36,938,415 bp and ending after 36,938,879 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66965 | AGT TAT AGT TTT TGA ACC AAA TGC TG | Mutant Forward | A | |||
| 66966 | GGT CCA TCA GTC CAC CAC TC | Mutant Forward | A | |||
| 66967 | CCG GAT ACG GAT TAC AGA GC | Wild type Reverse | A | |||
| 66968 | ACA GGA TGG ACA CTC CCA AT | Wild type Forward | A | |||
| 66969 | Fluorophore-1 | TGG TGC TTA ACA TGC GCT TCC T | Quencher-1 | MUT Probe | ||
| 66970 | Fluorophore-2 | TCT CCG TCC GAT AGC TCT GAT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66965 | 0.40 uM |
| 66966 | 0.40 uM |
| 66967 | 0.40 uM |
| 66968 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.