For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 109 bp
Sequence
Wt Sequence:
AATCCGGTGGGACCGCGCGTCCCCCTTTTAAGCTCGTGAAGCTTCTAGCTGCCTCGCAATCTTTTCTCCCTCCAGTCAGTCTCCCTTTCACGCGATGGATTCGGCGAAGACTTGTGTGACCAAGTTCAAGTCCTTTGCGATTTTGCTCTTCACCCCGATCCTGATGCTTCCACTCGTCATTCTGATACCTGACAAG
Mutant Sequence:
CAAGGCCAAGGAGCTGCCAGGGAGTCAAGTGATTTTTGAAGGCCCCACTCTGGGGCAGCAGGAAGACCAAGAGCGGAAGAGGTTGTGTAAGGCCATGACCCTGTGCATCTGCTACGCGGCCAGCATCGGGGGCACCGCCACCCTGACCGGGACGGGACCCAACGTGGTGCTCCTGGGCCAGATGAACGAGTTGTTTCCTGACAGCAAGGACCTCGTGAACTTTGCTTCCTGGTTTGCATTTGCCTTTCCCAACATGCTGGTGATGCTGCTGTTCGCCT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66789 | CTT CTA GCT GCC TCG CAA TC | Wild type Forward | A | |||
| 66790 | AAG AGC AAA ATC GCA AAG GA | Wild type Reverse | A | |||
| 66791 | ACC CTG TGC ATC TGC TAC G | Mutant Forward | A | |||
| 66792 | TGC TGT CAG GAA ACA ACT CG | Mutant Reverse | A | |||
| 66793 | Fluorophore-1 | TCA CGC GAT GGA TTC GGC | Quencher-1 | WT Probe | ||
| 66794 | Fluorophore-2 | CCA GCA TCG GGG GCA CCG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66789 | 0.40 uM |
| 66790 | 0.40 uM |
| 66791 | 0.40 uM |
| 66792 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.