For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 138 bp
>chr5:118672696+118672833 138bp CCACCATGCACAGCCTGA CTGATCTTCAATCAATAATGCTTCT
Sequence
Wt Sequence:
ctggcctggaactcagaaatctgcgcctgtctctgcctcccaagtgctgggattaaaggcgtgcgccaccatgcacagcctgagtcccttaaaaaggccttttttctaaacaGctctgcttTcttcaaaCgaggccctgacattactttgctcagcatttttctgtaaagatgtctaaagaagcattattgattgaagatcagataatcatcaatgaagtatttggca
Mutant Sequence:
CCTTTGTATACTTTTCAGATACTTTTGGGAATTGCCTAGATATTACTTTATGGTATCTTTGTTACTTTTTAATAGAAGTTGCTCAGAATTAATCTTTGAGACTTGGGAAGTTGTCCTAAGAGTATCAGAAGTGACTTGCCCTTTGAAGGCTGGAGAGGCCGGTGGGCCTGCATGGCCCCCTGAGCCCCCTGAACCCTGTTTTCTCTGCTGGCATTCCTGCCTTCCCCTGAGGACAGCATTTACTACCCCCTTTCGGCCAAAACTCATGACTGCCATTTATTATGAAGGGATAAATAAACCAGAAGTTCTAAACTCTGTAGCTCCACCCCTAACCAGTCACTTACAAAAGTAATATTTTAAATGGAAAGTGGAAAGCATGTTTCATTAGTATAAAGTTAGATTTATAACATCACATATTAAGGCAGTAAAGAAAGTTAGGATTAAGACAACTTGTATCAAAGA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65866 | CCA CCA TGC ACA GCC TGA | Wild type Forward | A | |||
| 65867 | CTG ATC TTC AAT CAA TAA TGC TTC T | Wild type Reverse | A | |||
| 65869 | Fluorophore-1 | CCC TGA CAT TAC TTT GCT CAG CA | Quencher-1 | WT Probe | ||
| 66547 | TTT CTC TGC TGG CAT TCC T | Mutant Forward | A | |||
| 66548 | GAA CTT CTG GTT TAT TTA TCC CTT C | Mutant Reverse | A | |||
| 66549 | Fluorophore-2 | CCC TTT CGG CCA AAA CTC ATG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65866 | 0.40 uM |
| 65867 | 0.40 uM |
| 66547 | 0.40 uM |
| 66548 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.