For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr16:23108407+23108548 142bp GTCCAAGTCCCAAGCTGTTG AGCCACGCAGAGACCCTTA
Mutant= 137 bp
Wild Type = 142 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCGGCGCGCGGAGCACTCGCGAGAGCTTCGCTTCCCAAGCGGGAGGGCCTGGTCCTAGGGCACTGAGTAAAGGGGCGTCTATACTTAGGGGTCCAAGTCCCAAGCTGTTGGGGAGGGCGAATGGCGCTTCGCAGCATTGCGGCCGGTTTTGAGGCGTTTTCAGCAGAGCacaggggcgcggaggggaatgaggtacggggtggaagggccctttaagggtctctgcgtggcttggaagcagtatgtctaactgcagtgttgttgtcagcagagaacatggcggcccagagggaatggaccccgatggtgtcatcgaggtaaggagtgggtgtggacgttaaaggtttggaaaggtacatttttttttcatgtcttattcatagtttcattattaacttacagagcaactggaatgaaattgttgataactttgatgatatgaatttaaaggagtcccttcttcgaggcatctatgcatatggttttgagaagccttcagctattcagcaaagagctattatcccttgtattaaaggtaaaactctattgccgttaggataagtgctctgcacatacatggaccggaaaagggaaagtgacctttggggaagtactagcacctgattgtattccttaaagtgaaatgatggcaaatcatctttcgggactgacctgaaatgaagagaatactcttgctgatcacttatgtgggcgtaactttatgttccaactggaatacatggtgtatagtagaagtaacgatttgatgtgggatcggtaaatatgtatcctactttttttagggtatgatgtgattgctcaagctcagtcaggtactggcaagacagccacatttgctatttccatcctgcaacagttggagattgagttcaaggagacccaagcactagtattggcccccaccagagaactggctcaacaggtattgatagtgtagttcaaaaaactgcttgcgtgttgcataggtttcaggtttcacaactgtgaagaatttaaaattaaaacgtataaattgtcctagtcctgtgagagcccccattttaattgtccatgcatgcagggagttttgttgaaagctaagcaggaaatgggtattgtaggtatgactttagggattgattgcacctcaacagttaaacccatAGGTTTCTCAGGGTGGATTATATCTGTACCCATTTAAAATTTGGAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTAAACATTTGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCACTGCTATATTGGCTTTGAAGTAATACTTCCTGATGAAGCTGCAAGCTTTATTCG
This mutation is a 995 bp deletion beginning at Chromosome 16 position 23,108,486 bp and ending after 23,109,480 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66408 | GTC CAA GTC CCA AGC TGT TG | Common | ||||
| 66409 | AGC CAC GCA GAG ACC CTT A | Wild type Reverse | ||||
| 66410 | TGC ACA ACT GCA TTC CAA A | Mutant Reverse | ||||
| 66411 | Fluorophore-1 | CAG CAG AGC AGG TTT CTC AGG G | Quencher-1 | MUT Probe | ||
| 66441 | Fluorophore-2 | TTC CAC CCC GTA CCT CAT T | Quencher-2 | WT Probe |
Strains Using This Protocol
This is the only strain that uses this protocol.