For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 121 bp
Wild Type = 115 bp
>chr9:107331589-107331703 115bp ATCATTTGGCTTTGGCTCTC AGAGGGTCGATCAGACTAGGTG |
Sequence
Wt Sequence (deletions in lower case):
ATCATTTGGCTTTGGCTCTCCCCCACCTGTCTTCAGTAGGAGCCAACTGCTTGGACTTCCTTGTAGaggctcctcaggagctaagatgatcagcacctagtctgatcgaccctcttccttccaggaactggttgaatgggttttagaggaagtggcccagaggccccatgcagtgagagcccaggatggtcccctcattctggaggtgggctgtggatcaggagccattactctcagcctgctgagccagctccccaaggtaggctgtctctgcatccctctaccatgccttgagccattgagatggtcccttctggtattctgtcccccacatccctctgtaagaagcattgagggaaagtggccatataaggaagatgtgcccagcccagcatgatcacagcctctaacttccatccttctccatctggctagagtctgaccacaggaaaactttgttatgtattcctttccaagagggagctaggggaagattgtagacagacatctcccagaaattcacctctcttcctttgttcttggggcagagtcgagttgttgctgtggataaggaggaagctgctgttagtctgacccatgagaatgctcagaggtacacgggctggaccttccagaaggccagcactggggaggtggactctgggacctgggcctgacctttattctagtacaaacccactagtgtttgacttgattctcgagggagagacacaatgaggaagcctggcaatggtcccatgggtttgcgagtggtggactgtgagccgtggttatgctgagccaagaagggctccctttccctcctggtccttgtagccaaggtttgcaccctatgctcagcactatctccccatctccaggcttcagctgcaggacaggatccggatcatccaccttgatataacttcaggtagatcccctgtacatcttggggtgggcgctgctgctggtggtgaggcactgcagaaatggggtaaggtaagggtttcccaataatcaaacctgtggctcatctcacaccagccctgctgagcttgctgcgggctcacaaggtgctggtgtctccttggctgacccgacccatgaagggactagccatgaggtccggcctttttctcctcttctctcctctcctctcctcccctctcctctcctctcctcccctcccctcccctcccttcccctctcctcccctcccttcccctctcctctcctctcttttcttgtctgtctttctttttatttcattttttgtttgtttgtttgtttgtttgtctttcaagacagggtttctctgtgtagccctggctgtcctggaactcactctgtagaccaggctggccttgaactcagaaatctgcctgcctctgcctcccaagtactgggattaaaagcctgtgcaaccactgctcaaccacaagcaataagggatcttctgggtcccctatgcctgataaatttgactaggacttatttcctgggaagaggtaaacatgttcaaagcaaagcagttgagagccaagtatggtggcagtgaggattcctgtgaactcagggtctgtctggggaacatggtgacttctagaccagcgtaggatataagcagaacatccccaaaaatcaaaataaacagcaacaataaaggaactttaggaccaaaatgcacgtgtggcctcctgcccacatggcctggatgaggtggtccagcagcgcctggtctgtgcaggttttgcagtgtcttcaggtttccagctccaattctgattcttttgttatccatggagcccccaagcgttgtatgagtgttagacacctgccttagcatctggtacaagtgggatccaaaagcagccataaggggttgtctgagggcagcaagtctgccctccctgtacatccagactatattggttgtaaagcagagaatggtaaggccaaggggctgcagagctgaggaaccctgcctttgcctttgcaatcaaggagggcttactggaggtggcacttgaatttggcttaatgaggaggccttgtcagggaggagagagagaacatggatattctaggtgaacagctacatgtctaaacatgtccactccggccagcctgctaactccggctactaatcctcgagtctggcttattaggtctaaagagagatttgaagagagggactacctaagggacaaggtggcaagcggatctgtcacctttcacacactatgcatgtatcttcctctttgctcacagaggggtgctgcacacaccttttgccctggagccccttggacttggtggtcagcaaccctccctacatcttccgcaaggacatggaacagctggctccagagatctgcaggtacagggtgggtgggacagcagagaagctctagcaggattggttggggtggaggcccttctatcaggagaagatggtgcagtatggaacagCAGGGTTGAGGGGTACACTTCAGAGCCTGCAGCCTTCCTGGGGAAGGTGTTACCT
This mutation is a 2406 bp deletion beginning at Chromosome 9 position 107,329,232 bp and ending after 107,331,637 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65029 | ATC ATT TGG CTT TGG CTC TC | Common | A | |||
| 65030 | AGA GGG TCG ATC AGA CTA GGT G | Wild type Reverse | A | |||
| 65031 | AGG TAA CAC CTT CCC CAG GA | Mutant Reverse | A | |||
| 65032 | Fluorophore-1 | AGG CTC CTC AGG AGC TAA GAT G | Quencher-1 | WT Probe | ||
| 65033 | Fluorophore-2 | CTT CCT TGT AGC AGG GTT GAG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65029 | 0.40 uM |
| 65030 | 0.40 uM |
| 65031 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.