For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:108168972+108169122 151bp GGCAGTGTGTGGAACAGTCC GCATTCAGTGTGTGTCTGTGTG
Mut= 168 bp
Wt= 151 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence:
gcaaccaggtagagtttgaattcttagctgaaaagaacaaaggtgtttatgaactgctgtccacctgtctgtcttcacccaactgtgggtaaatactgttgtgtggaatcccatggcagtgtgtggaacagtccacagttctaataatgataattgagaaaggaaaatcccacaccggtacagaaaaccactaccacctccaagatgaaggaaacccactgtagttggccacacatacacacgcacacagacacacactgaatgcagtatagtgagcatatcccacatgatgtgcctcaggaaaaggcaagcctccacagctcggaatgggtaccaaatttggagatgcctagatatcctctcttcccttcagagcagctaaaacaaggatgtgtgatcctactgtagaa
Mutant Sequence:
caataaaacttagcacacagctttgccattggattgccttagccaaggatgaggaaaagacaatgtcgagggtctctcactttctataacagaaagtaggtacaaaacagaggctccctgcaaccaggtagagtttgaattcttagctgaaaagaacaaaggtgtttatgaactgctgtccacctgtctgtcttcacccaactgtgggtaaatactgttgtgtggaatcccatggcagtgtgtggaacagtccacagttctaataatgataattgagaaaggaaaatcccacaggaaaagaacgtttttaaagtatagtaaaaatatagatagcagatatgagtattagatgagaattagagaaatttttcagtactactcctttctctcagctttctacctacatacctgtaatacctctctataggaatgtgacatccatcgcttcagagttgtttctcatggtcctgtattctgtgcctgccagagttatgtagcaagaccctttctcaaacacacacacacccacacacacacacacacacacataccagaaaccaacaaaacaaaacccaacatatgtggtaaagattaaatgt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64660 | GGC AGT GTG TGG AAC AGT CC | Common | A | |||
| 64661 | GCA TTC AGT GTG TGT CTG TGT G | Wild type Reverse | A | |||
| 64662 | GGT AGA AAG CTG AGA GAA AGG AG | Mutant Reverse | A | |||
| 64663 | Fluorophore-1 | AAA CCC ACT GTA GTT GGC CAC A | Quencher-1 | WT Probe | ||
| 64664 | Fluorophore-2 | AGG AAA ATC CCA CAG GAA AAG AAC G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64660 | 0.40 uM |
| 64661 | 0.40 uM |
| 64662 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.