For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:35114398-35114496 99bp CTTGTCCATTGCCGACCTT CTAGGAAGGGGAACACATCAG
Mut= 70 bp
Wt= 99 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AGAGAGTGGCATCTCTGAAGGGGAGGCGGGGTATGCAGACAAATGAATTGATTTATTTTTTTTCTGCCCCCCCCTTTGTGTTTTTGTTTTTGTTTTTTTAATTTGTCTTTGAGAATTCATGGACTAAAGTCAGGTCTGCGTGAATGCCAGGAAGATAGAGGTTCGGGAACAGTGGGAAGCTATTAACCAGGGTTATAACTGTCCCCTCTCCTCTAGATACTACTGTTCGCTTCcacgtacggggctgtggacagcatcattcctaccgatgtcaagaaaggcatgtgatctaccaatcagactacttgtataaggctgattgctgccagtacgattactgcaactcctggtccagtgctcagcaccagagcaccctgcgtgggtccccaggaagccatctgggcatgcccctgtcagcgtctcagataaaacagttttaccaggccctgaacctctctctgcctcagcctggcttccatgctcataaggtgtctgagggcctggagtctctcattctgcccccggagctgggcttgtccattgccgaccttcgccaaatatacttgttcctcaacagttcaggacttctggtccttccCTGGGATAGACCCTGATGTGTTCCCCTTCCTAGATTCTGCTCTGTCTGAGAGACTCTTCCTTTGAGGGGCCCAGCATCCTGCTCTGCGGTCTGTGAACACTCAGATCCTCTGAGCCCTCTGATCTCTTAAGCTTTCTGCTCTACATGGCCAAATTCTGTATGGCCCCTGGATCTGGGGCTGGTTTGTCCTCCTCCTTTTCAGGAAACTTAAGGACGGTTCTCACCAAGGCTGACTTGACAAT
This mutation is a 365 bp deletion beginning at Chromosome 17 position 35,114,431 bp and ending after 35,114,795 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64375 | CTT GTC CAT TGC CGA CCT T | Wild type Forward | A | |||
| 64376 | CTA GGA AGG GGA ACA CAT CAG | Common | A | |||
| 64377 | AAC TGT CCC CTC TCC TCT AGA TAC | Mutant Forward | A | |||
| 64378 | Fluorophore-1 | CAG TTC AGG ACT TCT GGT CCT TC | Quencher-1 | WT Probe | ||
| 64379 | Fluorophore-2 | ACT GTT CGC TTC CTG GGA TAG AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64375 | 0.40 uM |
| 64376 | 0.40 uM |
| 64377 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.