For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:173572614-173572742 129bp CCCCTTTGGCTCAAGATTTTA TCAGAATTCCTACGGGAAACA
Mut= 96 bp
Wt= 129 bp
Fam=Mut
Hex=Wt
The Mut Reverse primer (primer 64361) anneals over the nucleotide sequence containing mouse genomic variations rs223620354.
Sequence
Wt Sequence (deletions in lower case):
TCTTCTTTTTGGGTCCAGCTTCCATTTGAACTAAGCCAAATTAATTTTCTAAAAAGCCTTAGCAGCATCGAATTTCAGGCTCCTGTGCGACCATCAAGGGAGAGACTTCCCCCACCCCTACCCCCACGCACTCCCGCCCCTTTGGCTCAAGATTTTAAAAGTATCTTTGCGTGATTCAGGGCCAGacgtggtctgaactgatgcagtgatttctctaggtcctaattttgttaaaaggaaaaactgtttcccgtaggaattctgatggatgatgctaccctgaagttctacgatgtcatccccggagcacttatttcattatgtatctggcattacgatggttggacggaactggttttggccgccgtggaaggggaccccagcaaggtggtttcgtgctttttttttcaatattagggggcgaggggaccccagtctttagtctttagtgtgaaacttttgaataaagtcctcagagtagggaaggaagaagagctttctgcatggagagtgtttccagacagtctgggcttgtgagtccctcgGGCTTGCTTATCAACAGTTCATAAACCCACTTACTCTACCCGCAGTGGGGCCCAGGTGCTGCATTGTCTGTCCACATGTTGGCCAAGTTGAAAATCGAATTTAATCCTAGTTAAAGAACATGGGGTGGTAGCCCAGTGGTCAGGGGCTTGTGTACTCAGGTTGGTCTACCTTGGG
This mutation is a 360 bp deletion beginning at Chromosome 2 position 173,572,334 bp and ending after 173,572,693 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64359 | CCC CTT TGG CTC AAG ATT TTA | Common | A | |||
| 64360 | TCA GAA TTC CTA CGG GAA ACA | Wild type Reverse | A | |||
| 64361 | CAC TGC GGG TAG AGT AAG TGG | Mutant Reverse | A | |||
| 64362 | Fluorophore-1 | CGT GGT CTG AAC TGA TGC AGT | Quencher-1 | WT Probe | ||
| 64363 | Fluorophore-2 | CCA GGG CTT GCT TAT CAA CAG TTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64359 | 0.40 uM |
| 64360 | 0.40 uM |
| 64361 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.