For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:6389361+6389464 104bp GGGTGGGAGGACACAGTTTA ACTACAGCCACATCCCCAAA
Mutant= 118 bp
Wild Type = 104 bp
Sequence
Wt Sequence: gggtgggaggacacagtttatttaagaacccTctggtgacctgtgatcgtgagcacatttttgtcatttcagGGCTTGGTGACCTTTGGGGATGTGGCTGTAGT
Mutant Sequence: gggtgggaggacacagtttatttaagaacccTCtgtcagtcttaccgagtcatctttgttatttatttatttatttagtgtctatataacttagttttatgtatgtgggtgctttgcc
A 602 bp deletion beginning at Chromosome 7 position 6,389,393 bp and ending after 6,389,994 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63705 | GGG TGG GAG GAC ACA GTT TA | Common | A | |||
| 63706 | ACT ACA GCC ACA TCC CCA AA | Wild type Reverse | A | |||
| 63707 | GGC AAA GCA CCC ACA TAC AT | Mutant Reverse | A | |||
| 63708 | Fluorophore-1 | TAA GAA CCC TCT GGT GAC CTG T | Quencher-1 | WT Probe | ||
| 63709 | Fluorophore-2 | CTG TCA GTC TTA CCG AGT CAT CTT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63705 | 0.40 uM |
| 63706 | 0.40 uM |
| 63707 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.