For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:48552312+48552416 105bp TCCTCTGTGACTTGTGACATTT GCATTTTCCACTCTATTTCTCC |
Mutant= 80 bp
Wild Type = 105 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
tcctctgtgacttgtgacattttgtagtattaGGgggttaggatttatacccactctcaccaacgtgtttggagatacgg
This mutation is a 9774 bp deletion beginning at Chromosome 4 position 48,552,345 bp and ending after 48,562,118 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62922 | TCC TCT GTG ACT TGT GAC ATT T | Common | A | |||
| 62923 | GCA TTT TCC ACT CTA TTT CTC C | Wild type Reverse | A | |||
| 62924 | CCG TAT CTC CAA ACA CGT TG | Mutant Reverse | A | |||
| 62925 | Fluorophore-1 | TTT GCA GGC TAG CCA ACG A | Quencher-1 | WT Probe | ||
| 62926 | Fluorophore-2 | AGT ATT AGG GGG TTA GGA TTT ATA CCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62922 | 0.40 uM |
| 62923 | 0.40 uM |
| 62924 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.