For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:140025070-140025189 120bp CATAGGAAATTAGCCCTCTGTG ATTTACTGTCCCACTAATCATGC |
Mutant= 133 bp
Wild Type = 120 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
ttcatttgctctagtttgcttaggataattttcagataattcaactggatgttttaaaatcatctttccatgttataatttacagcagattggaGAtatgaagtccttaggcatgattagtgggacagtaaat
This mutation is a 3283 bp deletion beginning at Chromosome X position 140,025,108 bp and ending after 140,028,390 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62917 | CAT AGG AAA TTA GCC CTC TGT G | Wild type Forward | A | |||
| 62918 | ATT TAC TGT CCC ACT AAT CAT GC | Common | A | |||
| 62919 | TTC ATT TGC TCT AGT TTG CTT AGG | Mutant Forward | A | |||
| 62920 | Fluorophore-1 | TGC CCT CTA GAG ATA TGA AGT CCT T | Quencher-1 | WT Probe | ||
| 62921 | Fluorophore-2 | CAG CAG ATT GGA GAT ATG AAG TCC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62917 | 0.40 uM |
| 62918 | 0.40 uM |
| 62919 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.