For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:58877098-58877257 160bp AGAGGATGATTCTTGTGATGG CAGCTCACATTGTTTTTCCA
Mut= 162 bp
Wt= 160 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence: (deleted region in lower case)
TTAGATAGGCTAAATGCCTTTTTTCTTCCTAGCAGTAGTAATTGACATGTGACTGTTTCTGGTTAAGTTACCTTTTTTACATAAAAAGCTGACTTTAAAAAGAAGTTGTGCTTAGGGTCTTCCCCGAGATGAGTAATTTGGAAGCTGTAATAAACAGAGGATGATTCTTGTGATGGTTGTGTTATAAGAATAACTTTCTGTAAttgaatttttccctccatactcacttgccttctcttactgcattagaattttactataatttatgttaagatgggctatcctcgcctgccagtggaaaaacaatgtgagctggcccctacgcttcttactgccatggaagggaaacctcagccacagcaggataggtaaggcttcctcgcttacctgttcccatctgtaagagtcaacaacttttgcctttcagatacaggtcaagtctggttttacttggcaactggaaaggcttgggcttgtttacctgaaggatagTTGAATTTTCTATGATATTTTAGTTACTGTTTTATTAGTGGCATTATAAAGTTCTTCATATGAACACAAAAAAATATGTAAGACTGACACTTTCCTAAATTTAACTGCTTCACGTTTTTTGTTGTCTTTTTAAAAGTGGTTGTTTTATGTGATGTTAAAAATCTATTTCATTGATTTGTTTTCCTTTCATCTCATCTGGAGAGAAGGCACTGTTGTTAAGAGTACTGTCTGCTCTTTCAGATGACCCAGGTTCAATTCC
This mutation is a 289 bp deletion beginning at Chromosome 4 position 58876921 bp and ending after 58877209 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37536 | CGT GAA GCA GTT AAA TTT AGG AAA | Mutant Reverse | A | |||
| 62888 | AGA GGA TGA TTC TTG TGA TGG | Common | A | |||
| 62889 | CAG CTC ACA TTG TTT TTC CA | Wild type Reverse | A | |||
| 62890 | Fluorophore-1 | TGC CTT CTC TTA CTG CAT TAG AAT T | Quencher-1 | WT Probe | ||
| 62891 | Fluorophore-2 | AGT GGC ATT ATA AAG TTC TTC ATA TGA AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37536 | 0.40 uM |
| 62888 | 0.40 uM |
| 62889 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.