For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:114690181+114690291 111bp GCAAGTGTATTCTCTTCTGGGTATC GCATCCCATCGTTGGTCTC |
Mutant= 96 bp
Wild Type = 111 bp
Sequence
Wt Sequence (deletions in lower case)
GCAAGTGTATTCTCTTCTGGGTATCACCCCTAAcctttctttggggttttgcccgtagtgctgcggtgggcgttggtttctatggaaacagcgagaccaacgatgggatgcatcagctgatctactccctggacaacgcgaaccacaccttctctggaatggatgagctggtaaggattgtgggcaggtggctgggcacaggcacagcccatgagatcagcaaggccggaacaagggtaccagtcagatctcaggagcccagctgcaccctgtcgagttgtgtgatgggcgctgtgggccgggccgccttctgagccgttgccctgccaaaggcaaacacagtttctatgtcccagacatagggaggtttcagggcagctcggccccatcagaccgaccccctttggtctgcagaacatctgagaccttacccatccctgaaGCAGACCTCGGACATGGGTTCTGGAGTTGTTCTGTTGTGATTGTGTTTAAAGCGAGAGGTCTC
This mutation is a 409 bp deletion beginning at Chromosome 11 position 114,690,214 bp and ending after 114,690,622 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62828 | GCA AGT GTA TTC TCT TCT GGG TAT C | Common | A | |||
| 62829 | GCA TCC CAT CGT TGG TCT C | Wild type Reverse | A | |||
| 62830 | GAG ACC TCT CGC TTT AAA CAC AA | Mutant Reverse | A | |||
| 62831 | Fluorophore-1 | CGT TGG TTT CTA TGG AAA CAG C | Quencher-1 | WT Probe | ||
| 62832 | Fluorophore-2 | CCT AAG CAG ACC TCG GAC ATG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62828 | 0.40 uM |
| 62829 | 0.40 uM |
| 62830 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.