Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr15:85050415+85050512 98bp GGAAACAGAACCAGCTACAACC TGTCACAGCAGCTAATTGTGG |
Mutant= 94 bp
Wild Type = 98 bp
Large deletion: Mutant sequence with junction in uppercase
ggaaacagaaccagctacaaccccacaacaatatagaattaacTGcagcgttcctgtcagtgatagttaaaccttggaaggcttatgtggctta
This mutation is a 3638 bp deletion beginning at Chromosome 15 position 85,050,459 bp and ending after 85,054,096 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62819 | GGA AAC AGA ACC AGC TAC AAC C | Common | A | |||
| 62820 | TGT CAC AGC AGC TAA TTG TGG | Wild type Reverse | A | |||
| 62821 | TAA GCC ACA TAA GCC TTC CAA | Mutant Reverse | A | |||
| 62822 | Fluorophore-1 | CTG CAT ATA ACT AAG AAG GTC CCT CC | Quencher-1 | WT Probe | ||
| 62823 | Fluorophore-2 | AGA ATT AAC TGC AGC GTT CCT GTC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62819 | 0.40 uM |
| 62820 | 0.40 uM |
| 62821 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.