For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 123 bp
Wild Type = 123 bp
chr5:34178963-34179085 123bp CTTCAGCCTTGAGGTAAATCC AATCCCACAGAACTAGGCTCA
Sequence
Wt Sequence (deletions in lower case): CAGGCTGCTCCGGAGGGGAAATATTATCTAGGTCAGGAGGGAATTCCTGGAGAGGGATCTAACTACTTCAGCCTTGAGGTAAATCCCCAGGCCCAAAGGCAAGCCTACAGCAGCGcagaggcccatggagggtctggctggccacttcccaccttgcaccagacacatgagcctagttctgtgggatttgctgcctagcttgatagtctatctctggctctttcagacgagctaaactcaggctctacttggagcagctcaagcagctggtacccctgggccctgacagcacacgtcacactactctgagccttctgaagcgtgctaagatgcacatcaaggtaagtctcctcagctaccctgatgccccccagccatccccacccttgGGCAGCATTGGTTCAGAGGACCTGGAGGTGGGTGGTGGAGCCACCTAGCAGGTACGTGTCAGGAGCTTATGGGGAGGCCCAATGGGAGCTG
This is a 274 bp deletion beginning at Chromosome 5 position 34,178,762 bp and ending after 34,179,035 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 60338 | CTT CAG CCT TGA GGT AAA TCC | Common | A | |||
| 60339 | AAT CCC ACA GAA CTA GGC TCA | Wild type Reverse | A | |||
| 60340 | CCC ATA AGC TCC TGA CAC G | Mutant Reverse | A | |||
| 60341 | Fluorophore-1 | AGC AGC GGG CAG CAT TG | Quencher-1 | MUT Probe | ||
| 60342 | Fluorophore-2 | TCT GGC TGG CCA CTT CCC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 60338 | 0.40 uM |
| 60339 | 0.40 uM |
| 60340 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.