For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 145 bp
Wild Type = 138 bp
chr1:135363451+135363588 138bp CCAAACCTGAGGCCATGA GCTTGTCTAAGTGCCCTTCTG
Sequence
Wt Sequence (deletions in lower case):
AAGGTCTAAGATGCTCTGTGGAAGAGCTGATGTCTGCAGGTTTTCAGGTGCATGTGGCCCAAACCTGAGGCCATGAGGCTGATGTCAATCCACTCTCCTGAGTCCAGAACCCAGTCCTACCTctacagaactcaaccgaagaaggctgtcaaccttcccctagttaaatgtccttcagaagggcacttagacaagcccctccctgactggtctgcgcatgcgcttcctccctctgtggctagctctacatgtttatttttcttttctgaattcttaggaaagcaagcaagtggggaggaagacagatgccaagaatggagaggagaagga[...]gcggggattaaaggtgtgtgctaccacaccgggccagtctccagactttaagtctcctttagaacctttcacctttgcatgtttttgtttgtttgtctgtttgtttgtttacttaactggaaacacgatttagactgggctgggggctgggagcacacacacttcccaactctctgcttcccagagccaattaggcCTGGGATGACGTAATCATTTCTAAGTGCGTTTAAACTTGATGTGGGAGCGCAGCGCCACCTCGAGGAA
This is a 4824 bp deletion beginning at Chromosome 1 position 135,291,253 bp and ending after 135,296,076 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 60206 | CCA AAC CTG AGG CCA TGA | Common | A | |||
| 60207 | GCT TGT CTA AGT GCC CTT CTG | Wild type Reverse | A | |||
| 60208 | CTG GGT TGC AGT TTT CCT C | Mutant Reverse | A | |||
| 60209 | Fluorophore-1 | ACC CAG TCC TAC CTC TGG GAT G | Quencher-1 | MUT Probe | ||
| 60210 | Fluorophore-2 | TCA ACC GAA GAA GGC TGT CAA C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 60206 | 0.40 uM |
| 60207 | 0.40 uM |
| 60208 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.