For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 152 bp
Wild Type = 167 bp
chr4:91281147-91281313 167bp GAGCTTGGGTTACGGATTTG GGGCCCAAATGAAAAGTACA
Sequence
Wt Sequence (deletions in lower case):GTCTGTAGTAACTGTAGTTTCGAAATGTGGTAATGTGTCAGTCTGCGTGATAAAACACTGACAGATTCTGGGTTGCTGTTTCTATCTTCCGTCTCGCTCCGAGCTTTCTCTATGTCTTCTGGAGCTCCGCAGAGAGGTGCACCCAGTTTTGGGGCTGCTGCCATGTCCTGGATTAGGCATGTGATGTATGATGGGATGGCCTGGGcctgtgtggtttcataagcagcactgcttgctgagttctaaagatatctaaatttacaaatgacaggagcctgtgctaaaagctaagtcacctcctgtccgtgggtttgaactaacatgcctctcctcttccgtctcctcagggcagagcttgggttacggatttgtgaactacattgaccccaaggatgcagagaaagctatcaacactctgaatggattgagacttcaaaccaaaacaataaaagtatgttcacacttttcttaagtttgcttgtagaataagagtttatttgtacttttcatttgggccccgtgagcctgtcTGTGAGTCATACAGTATAATGTTTTTGTACTTATTGAACAAAGGAGGCAACTTTAATATTATATGTGGACATTTATATTAGCAGAAAGAGCAACAGTGCCCTCCGATATATACTGTATAAAGCCCCTAAATTAAGTCCTTATAGAGAGACTCCTTGAACTATTACTGGAGGGATTGTTGCACTTGTCTGAACAGCAATAGTTAGTGTTGTTTTGTAAGCCAGAAAGGCTCAGCCGTGTTTCTCACCTCTGCCCTTGACACAGATTATGAC
This is a a 325 bp deletion beginning at Chromosome 4 position 91,169,372 bp and ending after 91,169,696 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 59512 | GAG CTT GGG TTA CGG ATT TG | Wild type Forward | A | |||
| 59513 | GGG CCC AAA TGA AAA GTA CA | Wild type Reverse | A | |||
| 59514 | Fluorophore-1 | AGC TAT CAA CAC TCT GAA TGG ATT GAG | Quencher-1 | WT Probe | ||
| 59515 | CCT GGA TTA GGC ATG TGA TG | Mutant Forward | A | |||
| 59516 | GTA TAT ATC GGA GGG CAC TGT TG | Mutant Reverse | A | |||
| 59517 | Fluorophore-2 | ATG GCC TGG GTG TGA GTC ATA C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 59512 | 0.40 uM |
| 59513 | 0.40 uM |
| 59515 | 0.40 uM |
| 59516 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.