For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 98 bp
Wild Type = 110 bp
Sequence
Wt Sequence (deletions in lower case):
TGGATGGATGGATGGATGGGTGGATGGATGGGTGGACAGATGGATGGATAGATGGATGACTGACTTCCTATTTAGCTGAATTAATGGCTGACATCTAAGTCTCTGGGCCTAGAAGATGTTGGTGTATCCTATCTGTTCGGGCCATCTTGGTCAGTCCTGCCTATGTCTGTATGAACTCATGTCAGCTGTTGTCCACgagtggcaatcaagggcttcttctctcccttgctcccatccattatattcttcagtccctcacctcctcctcccttccctcccaggctgtgccttcgtgaagttttcttcccacacagaggcccaggctgccatccatgccttgcatggcagccagactatgccggtgagtgagagctgcgcttggctgaggcggggctgggtgcaaggtgggtgggagagatgggtggttttggcatcttcccttcatagactgcttcagacaggaggctggatgtgcagcccaggctgtgatcagagctgtgtgtgaccagacactgtcctggggcaagtgtagttcttagcttgtggcagtaacaCAGGCTGAGAAGCAGGGGCAGCAGTTGGATGATGTGTAGAGATCATGGACCCTGTTCTAGGGCAGCTGGAAGCCACGGTGGGTGCACAGAGTGAGGGGAGCTGCCAGGTCATTTGCATAGGTCCTTCAGGTCAGGTCCGCCAGTGAACAAGGGACAGAAGGACACTAAGAACCTAGAGGGGCAGGT
This is a 358 bp deletion beginning at Chromosome 10 position 81,305,085 bp and ending after 81,305,442 bp (GRCm39/mm39).
chr10:81469210-81469319 110bp GTGATCAGAGCTGTGTGTGACC CTCTACACATCATCCAACTGCTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 59177 | GGC CAT CTT GGT CAG TCC T | Mutant Forward | A | |||
| 59178 | Fluorophore-1 | AGC TGT TGT CCA CCA GGC TGA G | Quencher-1 | MUT Probe | ||
| 59179 | CTC TAC ACA TCA TCC AAC TGC TG | Common | A | |||
| 59180 | GTG ATC AGA GCT GTG TGT GAC C | Wild type Forward | A | |||
| 59181 | Fluorophore-2 | ACA CTG TCC TGG GGC AAG TGT AG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 59177 | 0.40 uM |
| 59179 | 0.40 uM |
| 59180 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.