For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 124 bp
Wt = 118 bp
Fam = Mut
Hex = Wt
>chr12:33342244+33342361 118bp AGTCCCATCTGTAACCAGTGA GCACCATCTCCCAGGTACTC
Sequence
Wt Sequence (deletions in lower case):
CACCGTGCCAGCCTCTCACCCCCTGTTGGTCCTTTACCCGGCACAGATCTCCCTCCCATCAAAACGGGGAATCACGCTGCTCGCTTACAGCAGGAGCATAAATAAGTGATAAGGAAGTGTTGTGATAACGATAAgcgggggtgtagctcctcggtggaccagatctatcaaagaaggcggtggtgcatgtgtgttcctttatttttcagcgttccagttcccgtagtcagtttagagaaaattcctaacctagtgaaggcagatggtgccaatgtcaaaatgaactctacaaccactactgcagccacttcctcctcctctgccgtctccactccgcctttaattaagcccaccttgatgtccaagtcagtgccaccttcaccagagaagatcttaaatggcaaggggattctgtcagccaccatagacaagaagcacccaaacggcaccaaaaacagcaacaagccttaccggagactttcaggtatgtgttcctgtggttagagtctggctcacggtaagatgacaactgagtcccatctgtaaccagtgatgtgttcgtagaggcaaacagctgtttggtttgaacagcgatctggagtgtagctgcaaGTAGGACCGGCACCCCGAGAGTACCTGGGAGATGGTGCTCTCATCCCCCAGTGCAGATAAGGTCCCCAGCCAAGTTTTGA
This mutation is a 478 bp deletion beginning at Chromosome 12 position 33,391,845 bp and ending after 33,392,322 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 57967 | GCA CCA TCT CCC AGG TAC TC | Common | A | |||
| 57968 | AGT CCC ATC TGT AAC CAG TGA | Wild type Forward | A | |||
| 57970 | Fluorophore-1 | ACA GCG ATC TGG AGT GTA GCT G | Quencher-1 | WT Probe | ||
| 58737 | CTC CCT CCC ATC AAA ACG | Mutant Forward | A | |||
| 58738 | Fluorophore-2 | CAC GCT GCT CGC TTA CAG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 57967 | 0.40 uM |
| 57968 | 0.40 uM |
| 58737 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.