For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 118 bp
Wild Type = 125 bp
chr8:104595006+104595130 125bp GCTGCCATGCTGACACTG GAGGGAGACTCTTAACCCTCTTTAC
Sequence
Wt Sequence (deletions in lower case):
GAAAAGGAGGCACAAGTTGGCTGGCAGGAAGGCCGGAAGCTCTCTATAAAATCAGAGAGCGCATTAGCAAAAGTGATGTTCTAGCAGTTTAGTATTTTTAATAACTTGAACTTTGAAGCTTTTATAAACTCTTGAAATTTCAGGCTGAAAAAACACTCCACCTCCACCTGCCACTTGTTTCAGAATGTCAAGTACTGTGTCCTACTggatcttcaattctgcaaggaatcgtattgctcttttacgaggtgggagacgcctatactcaagggctgccacgagtaggaacctgctgaagtggaggcccttttctccggcattggcatcatcagccctcaagtgtggttctccacctggtggctttgccctgcggaaagcctacagacacacatcaaccgaggaagaggatttccacctacagctcagccccgaacaggtcagtgacctgctccgagctggcgagtcatcccacaaggtccttgatttcaacaacggagtaccaaattcagtgttaaggttcgagagcaaccagctggctgccaattcccctgtggaggaccggcaaggtgtggctacctgcgtccaaacgaatgggatgatgttcggtatttttgatggacacgggggccacgcgtgtgcgcaagcggtgagtgagaggcttttctactacatggcggtgtccctgatgtcccatcagaccttggagcagatggaggaagcaacggaaaacatgaagcctttgctgcccatcctgcgttggctcaagcaccccggagatagtatttataaggacgtcacgtccgtgcatctggaccacctccgtgtctattggcaggagctccttgacctgcatatggaaatggggctgagcattgaagaagcattgatgtactccttccagagactggattctgacatctcgctagaaatccaggctcctctggaagatgaggtaacgagaaacttatccctccaggttgctttctctggggcaacagcctgcatggcccacgtcaatggagttcacctgcatgtagcaaatgctggtgactgccgggctatcctcggtgtccaggaagaaaacggtgcctggtcatgtttacctcttacctgtgaccacaacgcctggaatgaggctgagctgtcccggcttaagagggaacaccccgagtccgaggacaggacactcatcatagacgacaggcttctgggtgtcctcatgccctgcagggccttcggggatgtccagctaaagtggagcaaagagctgcagcggaatgtcctcgcaaggggctttgatacggaggccctcaacatctaccagtttaccccgccccactactacactccaccctacctgactgccaaacctgaggttacctaccacaggctaaggcgccaggataagttcctggtgctggcctcagatggcctgtgggacatgctggggaatgaggacgtggtgaggctggtggtggggcacctgtccaaggtgggtcgccataagccggacctggaccaaagaccagccaacctaggcctcatgcagagcctgctgctgcagaggaaagccagtggactccatgcggctgaccagaacacagccacgcatctgatcagacacgccatcgggagcaacgagtacggggagatggagccggagcggctggctgccatgctgacactgccagaggatgtggccaggatgtaccgggaTGATATCACTGTCATGGTGGTGTTTTTTAACTCTGATTCAATTGATACCTACTGTAAAGAGGGTTAAGAGTCTCCCTCTGGTGCCAAGGCTAACAGGAATGCCCTTTAGACACTTCACTCCTTAGTGAGCAATCCAAACCTTAGTAAAGAATAGGCAGAC
This is a 1510 bp deletion beginning at Chromosome 8 position 105,320,175 bp and ending after 105,321,684 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 58303 | CCT GCC ACT TGT TTC AGA ATG | Mutant Forward | A | |||
| 58304 | GAG GGA GAC TCT TAA CCC TCT TTA C | Common | A | |||
| 58305 | Fluorophore-1 | TCC TAC TTG ATA TCA CTG TCA TGG TG | Quencher-1 | MUT Probe | ||
| 58306 | GCT GCC ATG CTG ACA CTG | Wild type Forward | A | |||
| 58307 | Fluorophore-2 | AGA GGA TGT GGC CAG GAT G | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 58303 | 0.40 uM |
| 58304 | 0.40 uM |
| 58306 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.