For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:27193898+27194005 108bp TGTCCAGGCCTTCTTCCTT TCCTAGAAATCACTAGAGAGCACCA
Mut= 115 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TAATATACAGAAGCTTGTCACCGAAGAGTTTTCAAGGGTCGGTGGCGAGCGGCTTGAGACAGGTCTCATACCCCGAACTTGTGTGACCCCAGTCTCTTTCCTCCGCAGCCTTCACCCCGTATAGAACCCTGCACTGCCCGACTCCCCGGGATTTATTTCTCTTCCCGAGGTAGCCATGGatgcttcgactcctttgcctcccgcatcctcatctccgagatgcaacccagccccacagacaatccacattgagttccctcatcatagctcttcgctgctggaatccctgaaccgccacaggctggagggaaagttctgtgatgtgtccctcctggttcagggcagggaacttagggctcacaaagcagtgttggctgctgcctctccttacttccatgacaagctgcttttgggggatgcgccccgactgactttaccgaatgtcatcgaggccgatgcgttcgagggactgcttcagctcatttattcaggaagcctccacctgccgctggatgccctccctgcccatctccttgtagccagcggccttcagatgtggcaagtggtagatcggtgctcagagattcttcgagaactagaaacgtctggtgggatttcagccggtggaagagcctccagcctcacacttatttccacaacatcttcaggaggctggtgcattcgctcttcccctttccagaacccagtacgctcctctgcttctacagagaattctgttctccctgagagccccgctggaggggaggggagtgaactagaaggaatgttacagattcaggtgaaagtagaggaggaagaggagcaggggtcagcagctccactctttcagactcctcagccggagagagtgtcgggaggggtttcccaagcttgtggatcccacccattgcctacacctgctcttcccagcaagccttcagaggatgagagctcaacagtagatcctcctgcccctcctgtacaagcttcccaaatcttatatgtgaatcaggaaaacgttgagtgtaaggaggagatagcaagaggcacaaaggaaaagaccaaagtactatctggagaggactctgaggagaaggaggagctgagatacttgctgtcctcaggaggaggggaatcgtctggggcaggagatccatcgtggaaaccagtggatcttcatgggaatgaaatcctgtcaggggatggaggacctggaggaacagggcaggctatgcatgggcctgtgaagctaggagggacaccccctgcagatgggaagtgctttgcttgcttgtgtggaaaacggtttgcagtaaagccgaaacgagaccgacacatcatgttgacgttcagccttcgcccttttggatgtggcatctgtaataaacgtttcaagttgaagcatcatctaacagagcacatgaagacccatgcgagagctctgcatgcgtgtccccattgtggccgtcgattccgtgtccaggccttcttccttcgccaccgggacttatgcaagggccagggctggcccacttaccactgGACTTACAAATGACTACTGGTGCTCTCTAGTGATTTCTAGGACAAGATAGCCCCTGCTGCTGCTGGACTCTTACCTTCACCACCTCAGTCCTGGATTGTATAATCATTCCAAGAGATTATATATATTGTCATGAACCCCTTACTCTTGGGTATGGGTCTCACCCTGGTAGT
This mutation is a 1363 bp deletion beginning at Chromosome 17 position 27,192,601 bp and ending after 27,193,963 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 58279 | TGT CCA GGC CTT CTT CCT T | Wild type Forward | A | |||
| 58280 | TCC TAG AAA TCA CTA GAG AGC ACC A | Common | A | |||
| 58281 | AGC CTT CAC CCC GTA TAG AAC | Mutant Forward | A | |||
| 58282 | Fluorophore-1 | CAC CGG GAC TTA TGC AAG G | Quencher-1 | WT Probe | ||
| 58283 | Fluorophore-2 | CGA GGT AGC CAT GGG ACT TAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 58279 | 0.40 uM |
| 58280 | 0.40 uM |
| 58281 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.