For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 93 bp
Wt = 108 bp
Fam = Mut
Hex = Wt
>chr19:42041693+42041800 108bp TCGAGTCACCAGAGTCACCA CAGGGACACATGGTTTCAAG
Sequence
WT Sequence (deletions in lower case):
GGTGGTGCTGGGGACCGCTCTCTTGCTCGGAGGTGGAGGCCTCATGCTGTGGGCTCACAGGAAGAAAAGGAAGGCAGccactgagactacagaagacaagcctctggaatcccaccgagcaaatgacagctggatcaaatctcacttcagccgcctatccgaggagaggttgcccacctaccgctatgtcagcaacaatggccactcacctgaaagcaggcatggggaagtcaataccaccctccacgtggataccctcaccaccaaacacggagaaaggggcgcggctctgcaccgagattcgtttgccagcaaacagaagatatctggaagctcaatgaccaaagagatgcagagggagtcagggaagtccccgtccatggaggatgacacctgggctgctgtggcagcttgtacgaaggagattgatgccaaggggcatcgcgtggctaactccatgctgcagcgctccacaactcaccgtcgtaaaggccatgcagaatccaggaacatcagcccagaagagctgaaggctctggaggaggtggagataaaactgaaagggaatttcctaactcaccatgaaactggagtagctggggccaaccaatcgcacacagtctatagccagagtcgccatagtaaccaaagccaccattcctatccaagccaccagagcaaccagagtcatcccgtttactccagctaccagggtcatcatccaagtcacttgagcccccagagttatccaagttactcaagtcaccagagtcatccgggccactccaaccaccagggtcattcaggcctctcaagccaccagactcatctgggccactccaaccaccagggtcatccaggtcactcgagtcaccagagtcaccagggtcagccaggtcacccaagccaccagagccataatctgcccaaccgcagaaacCCAATCTATGGCTCTTGAAACCATGTGTCCCTGCCCCCCACAGGGCTGGCT
This mutation is an 863 bp deletion beginning at Chromosome 19 position 42,040,905 bp and ending after 42,041,767 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 58132 | CAG GGA CAC ATG GTT TCA AG | Common | A | |||
| 58133 | TCG AGT CAC CAG AGT CAC CA | Wild type Forward | A | |||
| 58134 | CTC TCT TGC TCG GAG GTG GA | Mutant Forward | A | |||
| 58135 | Fluorophore-1 | CAA GCC ACC AGA GCC ATA ATC T | Quencher-1 | WT Probe | ||
| 58136 | Fluorophore-2 | CAG GAA GAA AAG GAA GGC AGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 58132 | 0.40 uM |
| 58133 | 0.40 uM |
| 58134 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.