For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 98 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
>chr9:28813184+28813286 103bp GCCTGAGAGGCAAGTGTAGT CAAATATCCATTCGCTGTGA
Sequence
Wt Sequence (deletions in lower case):
CAGCAAGTGGCAACTGTGACGAATTTAGAATGTATGTGACTGCCTGAGAGGCAAGTGTAGTATCTTCACATTTAAATGTAAcatcttcctaaaatgaatggttggttgactaaggggaggggtgtcacagcgaatggatatttgtcttctctggaattaagttttaatttatttattttttctgtctgtcttgcttttatttctccagaccctccctatatatctaaagccaagaacactggtgtttcagtgggtcagaagggcatcttgagctgcgaagcctctgctgtcccgatggctgaattccagtggttcaaagaagataccaggtaccttgaaggaactgggggagctctgacacagagctgattaatcatgcatcccccagaaggagggtcacaaactccaggggtaaaataaacaagataaaaacatgctataacctccttttaatggagtcttcttttagaatcagaagtgagaaagaaaaaaataaatagagggagctgagaactcaacaaaATGGATTGTCCTTGTTTAAGAATCTTGGATTACAAAGTTTGGAGCTGAGACAAAAGGA
This mutation is a 441 bp deletion beginning at Chromosome 9 position 28,813,224 bp and ending after 28,813,664 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 57951 | GCC TGA GAG GCA AGT GTA GT | Common | A | |||
| 57952 | CAA ATA TCC ATT CGC TGT GA | Wild type Reverse | A | |||
| 57953 | TCC TTT TGT CTC AGC TCC AA | Mutant Reverse | A | |||
| 57954 | Fluorophore-1 | AAT GAA TGG TTG GTT GAC TAA GGG | Quencher-1 | WT Probe | ||
| 57955 | Fluorophore-2 | AAT GGA TTG TCC TTG TTT AAG AAT CTT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 57951 | 0.40 uM |
| 57952 | 0.40 uM |
| 57953 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.