For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:46830210-46830355 146bp AGGCCAGGGTGTTGCTTAGT ACTAGCTCCAGTGAAATCTCTCCA
Mut = 132 bp
Wt = 146 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TTCCTTTTGGTTTTACTTGTTATTTTTTTTAGTAAGTCTGGGGATGGCAGGCCAGGGTGTTGCTTAGTTTTATTTTTAGCTCACCAAGcaagggcaaggtccaagttcaccccccaggactgaagcagtaggcgcttcccagagacagaagtgtagaaaatggtttaaaatggagagatttcactggagctagtgtttcgtttctttttgccttatataactatcagcagctatttacgtagaagtagcagtacttacttgtttcactctctcacttccttcttttctagagacccacaagcattgaactattttctgcacggacctagcagtaaatcggtaagtgacagacaagtgtctcaggctcggcttttgtctctccaagccctgcagtaactgccatgttgaattccccctctgcagggcagcgatgatgtgacgaacgcagggtattctgcagccaattctaattcaattttcgccaactccacggtgagtgctgaaaaccagacctgaagcctttctgtctcaaggaaaccttacaagagaggcttcgattgcctctgtagagtgcaaagaatcattacctcaccttgtgactgacaggagagggaaaacctGGATGACAGTATGTCAGTGCTCTGTTTGTCATAGAATCAGGCTCTTAAGTTTCTTCTTGCTTTTGACATTCCTCTATGTTACGTATGCGTGAG
This mutation is a 532 bp deletion beginning at Chromosome 17 position 46,829,784 bp and ending after 46,830,315 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 54810 | AGG CCA GGG TGT TGC TTA GT | Common | A | |||
| 54811 | ACT AGC TCC AGT GAA ATC TCT CCA | Wild type Reverse | A | |||
| 54812 | TCA CGC ATA CGT AAC ATA GAG G | Mutant Reverse | A | |||
| 54813 | Fluorophore-1 | ACT GAA GCA GTA GGC GCT TCC | Quencher-1 | WT Probe | ||
| 54814 | Fluorophore-2 | CAA GGG ATG ACA GTA TGT CAG TGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54810 | 0.40 uM |
| 54811 | 0.40 uM |
| 54812 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.