For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:155070674+155070784 111bp CCCACTCTGCACCCTATGCT GCGAGTACCTTGGTGTTGCAC
Mut= 109 bp
Wt= 111 bp
Fam=Mut
Hex=W
Sequence
Wt Sequence:
CCCACTCTGCACCCTATGCTTAGAGGAACGAAGACACTCCACGGCCACACCTTGTGGCCATCTCTTCTGCTGGGAGTGCATCACCGAGTGGTGCAACACCAAGgtactcgc
Mutant Sequence:
CCCACTCTGCACCCTATGCTTAGAGGAACGAAGACACTCCACGGCCACACCTTTGCCATCTCTTCTGCTGGGAGTGCATCACCGAGTGGTGCAACACCAAGgtactcgc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 54180 | CCC ACT CTG CAC CCT ATG CT | Forward | A | |||
| 54181 | GCG AGT ACC TTG GTG TTG CAC | Reverse | A | |||
| 54182 | Fluorophore-1 | CAC ACC TTG TGG CCA TCT C | Quencher-1 | WT Probe | ||
| 54183 | Fluorophore-2 | CCA CAC CTT TGC CAT CTC TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54180 | 0.40 uM |
| 54181 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.