For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = GTTC
Wild type = ACAG
>chr2:181113013-181113102 90bp CTGGAAGCTCTTGGGATCG CTTGAAGTCATGGTAAACAGCAG
The For primer (primer 54043) anneals over the nucleotide sequence containing mouse genomic variations rs27642401 and the Rev primer (primer 54044) anneals over the nucleotide sequence containing mouse genomic variation rs227134979.
Sequence
ATCTTGCGGATGATCCGTATGGACCGGAGGGGTGGCACCTGGAAGCTCTTGGGATCGGTAGTCTACGCTC(a/g)(c/t)(a/t)(g/c)CAAGGTGAGCAGCACTGACCCAGCCTGGAGCCTGCTGTTTACCATGACTTCAAGGCTCCAGGCTGCTCTA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53556 | Fluorophore-1 | CTC ACA GCA AGG TGA GCA GC | Quencher-1 | WT Probe | ||
| 53557 | Fluorophore-2 | CTC GTT CCA AGG TGA GCA GC | Quencher-2 | MUT Probe | ||
| 54043 | CTG GAA GCT CTT GGG ATC G | Forward | A | |||
| 54044 | CTT GAA GTC ATG GTA AAC AGC AG | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54043 | 0.40 uM |
| 54044 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.