For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:85272294-85272409 116bp ACCTTATGCTTACATTGCTTCC TTTCAGACCTCGTTAAACTACCC
Mut = 122 bp
Wt = 116 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TAGTTCCGGTGGTTTGATTCCAGGCCAGGATGCTGGCCCGATTCTGTCTccctttgttccgtgcagtctcaccgcacctctctttctctcttttcttcccttaggctgagggtaaaaagctaggtttggtgggctgggttcagaacaccgaccggggcaccgtgcaagggcaactgcagggccccgtctccaaggtgcgcttcatgcagcagtggctggagaccagaggaagtcccaagtcgcacattgacagagcaaacttcaacaatgagaaagtcatcgcaaacttggattattcagacttccaaattgtaaaataatgaaacgaatcttaatattttttcaaaataatctcactcctttttttaaatcgctagattaaaaaaaaaatagaactattctgtgctcagtattagaatttgttagtaagttattttggttgcatgttggaaaagttaccacgtattacaagtatgatgaaatacaaatgtgtataattctaaccaataaaaacacattagaaccttatgcttacattgcttccccccctcccttttaatccttagtgaactttgggcaacatgattaattcgttattgtGAGAGGAAAATTTTGGGGTAGTTTAACGAGGTCTGAAAGAGAAGTAACTTTGCCATTTCTTTACATTGTTTAC
This mutation is a 551 bp deletion beginning at Chromosome 12 position 85,272,332 bp and ending after 85,272,882 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53061 | TTT CAG ACC TCG TTA AAC TAC CC | Common | A | |||
| 53062 | ACC TTA TGC TTA CAT TGC TTC C | Wild type Forward | A | |||
| 53063 | GGT GTC TGT TTT GAT TTT TCT GGA C | Mutant Forward | A | |||
| 53064 | Fluorophore-1 | CTT TGG GCA ACA TGA TTA ATT CG | Quencher-1 | WT Probe | ||
| 53942 | Fluorophore-2 | ATT CCA GGC CAG GAT GCT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53061 | 0.40 uM |
| 53062 | 0.40 uM |
| 53063 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.