For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:45775455-45775623 169bp TGAAAGGCAGAGAAAATGAACA ACTGGCCCTGAGATGATAGC
Mut = 162 bp
Wt = 169 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TTTTATGAAAGGCAGAGAAAATGAACATTAAAACAATTTTTATATATTAATTGGATctcaggtttaaatcaaaagtaatgaggtatgttactttcttataattttaggattgtataccatctcttgattcttcacagtcaacgccaacagaggagctatcatctcagggccagtcccacactgataagattgaatgccaagcagaaagttacctaaatgcactctttcgaaagaaaggtaatactggcatgctttgtcatttaaagtttgcattgtttaggtttttcttatatatcagtccctactttattgttaacgacttctttttttgtcttactagagccaataagagtgtcagctctctagtgctagccatttgttatccgcctcctgttctcaacttcttcatgggcacctctcaaaatattttttgtgcttcccactttcattattttcttgctattctcaagtctttaaaaagtgctggacgatgaagaagctatagataggttatattgcaggcctatccctagtactgtatctcttacatcatttcccagctggtgtaccacttaagtatttgtcagcttgagtatgcgtgcttgacattaaaaagtctgttctgtatttgtctctCTCTGGCGTCTTTCAACCAAATGGGTCTTGTTTCACTTATTCCTCTACTTGTTACATATCTATAAGGAAAAGTAGTTTTTATATTTAAACTGCTTGGGAAGATTATAG
This mutation is a 580 bp deletion beginning at Chromosome 5 position 45,774,993 bp and ending after 45,775,572 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53258 | TGA AAG GCA GAG AAA ATG AAC A | Common | A | |||
| 53259 | ACT GGC CCT GAG ATG ATA GC | Wild type Reverse | A | |||
| 53260 | CGA CTA TAA TCT TCC CAA GCA | Mutant Reverse | A | |||
| 53261 | Fluorophore-1 | CTT GAT TCT TCA CAG TCA ACG CC | Quencher-1 | WT Probe | ||
| 53262 | Fluorophore-2 | ATC TCT GGC GTC TTT CAA CCA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53258 | 0.40 uM |
| 53259 | 0.40 uM |
| 53260 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.