For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:118647885+118647989 105bp TGTCACCCATGAAAAAGCTG TGGTGGAGGAGGACTTTGTG
Mut = 107 bp
Wt = 105 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AATCCCAGAAATGTGAGATTATGCCCCTATAGTGTATTAAGCAATAGTTGATGATCTTTTGTTGTAGAAACATGgatagtattctcataatctctctgtgaggttatattgttatccccatcatacagatgtggaaactgaggctcagaatacttaatggggcaagagccctctattggcagactttaggctttcaggctatgcctgtctgatcctgtcacctgtacaacattgtgctggtaattctcccttctttgagagaagaatttggactgcccatattacctttcattatcactgagtgacctgtctcatccctgcatgcctcaacaccttcataataatgtttgcacattttggtttctgccttcccccagtatggccaagtacttccggaacaacttcatcaacccccacatatactccagagggattgctaagctcatcttttgctgggacttcactgtcacccatgaaaaagctgtaaagctaaaacagaagaatctgagcacggagatcagggtaagtcccagactccagagtcctccccacaaagtcctcctccaccagccttcctcacccctgcgtgtctacagcttttttcctccccccccccctcctcttccctgcttttccttccctttcccaattccctttctctttccctttgtgatagggtttcagccaggctgaggtgtgtacatcttaatcccagcacctcaggagccaggggcaggtagatctttgagagttctaggctggggcgggggtgggtgggatggtggggtggagtggggtgaggggtgttcatgtgtatcacaagctgatctggaatttaagatcctccttcctcagacttcctggtgctgagattataaacctttgcctccactcgtggtcttgtctataaaatatttaattatggataacacccaatgccagccagtgcatggggacatcatgccaggctttgtggttgtctcagtcttcactggggccagtttagcaattcctctgaaaaaacatcctcttcttgagcttccacattaaaagttctaccctagagcagtgattttccatctggagcaaccgtgtccctcagtgcgggggagcttgggctatctctgaagaccgcgttcagttgctacagttagggtaaaggtgcggtggtgtctagtgggtaaggtttgggatgccatgaagcactccatgtacaaggcaagcacagtctgaggcggaactgccctggtctacagagacgcctttaatcccagcattggaggggcagatgctggaatccaaggccaacctgatctacacaatagggagttccaggacagccagggttacagaatgaaaccctgtttcaaaatacaaatcaaaacaacaataacagtaaagcccatcaaaataaaataaaccataacttatcaataaatgagctttgatggcagctttaacttcttccccccatgtggttctcagaattgttcgttaagaaaggcttctgtggagtgttttgttatggtatacacctgccatcctggagaggcggaggctggggattgtatgtttaaggacaggctaggctacactgtaagaccttgtttcctccaaacacaaagataaaaaagaagaaaggcaggaagagagtgtctgaaggagggagggagggagggaggagggggaagggaagggatgaagagagacaatgaggagaggaggagaagaggaaagagaaagaaggagcagagggaggcagcacagaagaacgcacaccatgaccaagggcctcttaggtctctctgttggtccaagatggaaatggagtttgaagtccttgtgcttttctggcgtcttgaggtttccccttggtctcccatgatccagctcgcagacttgcagcagacttaccctgcagcttctgtgtgatctgggctagccctgtgctcctgaggattgctgctgacaagcagggaagggccagtgggtcccactgactgttctcctggcacttgcaggagaacctgtctgagctccgccaggagaactacaggctcacattcaaccagcagctgacccgattttctgctcacgtagccgcttggctcgtctctactggagtgaccgcagcctgctgtgtagctgtctactacttggctgagtataactctgaggtaactctgcggaccagagcagagagagctggggaggactgggaggccactgggcagatgcagagcagatgcctccagcagggccctgtggccagcagcaactgcacccatagagaccttgcttcaaaatgcagaaccaagcctcttctcacggccagatctgcacttaggagcccccagggtgTAATGCACATCACAGGGCAAAGTGTACCAGGCTCCTGTGGACGTGGGACTTTGGCAGAGAGCTGG
This mutation is a 2287 bp deletion beginning at Chromosome 7 position 118,647,495 bp and ending after 118,649,781 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53237 | TGT CAC CCA TGA AAA AGC TG | Wild type Forward | A | |||
| 53239 | TGG TGG AGG AGG ACT TTG TG | Wild type Reverse | A | |||
| 53240 | ATG CCC CTA TAG TGT ATT AAG CA | Mutant Forward | A | |||
| 53241 | CAA AGT CCC ACG TCC ACA G | Mutant Reverse | A | |||
| 53242 | Fluorophore-1 | CAC GGA GAT CAG GGT AAG TCC | Quencher-1 | WT Probe | ||
| 53244 | Fluorophore-2 | ATG TAA TGC ACA TCA CAG GGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53237 | 0.40 uM |
| 53239 | 0.40 uM |
| 53240 | 0.40 uM |
| 53241 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.