For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:76620341-76620465 125bp AAATACTTCTCAGCAACAGGAGTC GCACAGAGAGTTAGAGGTGACAGA
Mut = 114 bp
Wt = 125 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGCCCTTGTCATAAATAAGAGTGTTCATTACTTCCTGGGAATCTGTAACTGAGCTTTTTAAAATCTCATGTCATGTTATGCATTTCTACAAGAACTGACTCAACTTTCAATCTCCCtcatttctgaagtgtggtgggagccagttataaagaatccgtgctgtcctttgagtaactgagaatccatggctccagtcccacagctccttgaagggttagagacatagctcagtggtcgagcatttgcctaccacacacaaggtcgccaagaccatgaaaaatggaagtttgacattgtgtggtcctgatctgaaatttgcctataaataaatcccttctttgccttcctcctcctattcctccagggtatcaaccttgtgacccccaggtcatccaggaccgtgtcagccacctagagcagtgcttcagtgaactgagcaacatggcagctggacggaaggctcagctggagcagtctaagcgactctggaagttcttctgggagatggatgaggccgaaagctggatcaaggagaaggagcagatctactcctccctggactacggcaaggacctgaccagcgtgctcatcttacagcgcaagcacaaggcctttgaggatgagctccgtgggctggacgcccatctgaaacagatcttccaggaggctgacgacatggttgcacaaaagcagtttggacacccacagatcgagacccgtgtcaaagaagtgtcagctcagtgggaccacctgaaggagctggctgcctttcgtaagaaagacctgcaggatgcggaaaacttcttccagttccagggtgatgcagacgacctgaaggcttggctgcaagacgctcaccggctgctctctggtgaagatgtagggcaagatgaaggagccacgagggccctgggaaagaagcacaaggagttcctggaggagctggaggagagccgaggggtgatggagcacttggagcaccaagcccagggcttccccgaggagtttcgagattccccagatgtaacaaaccgactccaggcactcaggaagctctaccagcaggtactgacccaggcagaattgcgtggacacaagctgcaggaagccctggacttgtacaccgtgtttggggagtcagatgcctgtgagctgtggatgacggagaaggggaagtggctggaccagatggatatcccaaacacgctggaggatctggaggtggtgcagcacaggtcagacagctcagccttgctcatccccacccgagagctgagggtcacctcccactgctagaccctcctctgttacatagtgcaggcatcaggaattgagttctggtctgactccggggcctccgattcttcacccactggcacttcatagttctggagacaaaggggttttttaaaaaatatattattaaaatacttctcagcaacaggagtctttactcagatgaattctgagcattgggatacaggaAGAGAGGAGGTGCTGTGGACATGGGGCTGAGAGGCTGGGATTCTGTCACCTCTAACTCTCTGT
This mutation is a 1369 bp deletion beginning at Chromosome 12 position 76,620,406 bp and ending after 76,621,774 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50313 | GCA CAG AGA GTT AGA GGT GAC AGA | Common | A | |||
| 50314 | AAA TAC TTC TCA GCA ACA GGA GTC | Wild type Forward | A | |||
| 50316 | Fluorophore-1 | CTC AGA TGA ATT CTG AGC ATT GGG | Quencher-1 | WT Probe | ||
| 50317 | Fluorophore-2 | CAA CTT TCA ATC TCC CAC AGA GAG G | Quencher-2 | MUT Probe | ||
| 52319 | GTC ATG TTA TGC ATT TCT ACA AGA AC | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50313 | 0.40 uM |
| 50314 | 0.40 uM |
| 52319 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.