For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:96517780-96517892 113bp TTGGCAGCAAAAATGTTGAG CAGAAACAAAGCCTGCAAGA
Mut = 114 bp
Wt = 113 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GCATCAAATCCCATTACAGATGGCTGTGAGCCACCATGTGGTTGCTGGGAATTGGTCTCAGGACCTCTGGAAAAGCAGTCAGTGCTTTTAACCTCTGAGCCATCTCTCCAACCCCTGGACTATTTAATTTAAAAgaaggtagttgagaaacttagaaacatggctaagaaactaagttccatgcctttagctctagtacttgagaggcagaggcaggtggatttctgtgagttccaggtcaaactagtctacatagtaagttccaggccacctagggctacatagtgagaccctgcctcaaccaaacaaaacacacagagaaagaaagggagggagggagggacagagggagggaccgagggaccgagggaggaagggagggagggaggaaaggaggaagggaaggagagagacagagagagagtgaataaaggacaaactagaacagagcctttagaaaagatagtgttcaatgaataattgttttaaaagaggaaaacttaattttcatgctatgtttccttgtagaaaatcatcttggcagcaaaaatgttgaggtccctgagaggctcaacttgggaacacatgggaactcagagcacactggtagccctgatggaagtttcttcatcttgcaggctttgtttctggagcagaaggggcacaccacttgcccagtgactacattggaaatcattgattgcaagatggatctgtggtctctggggcgacttgggaaagctctgcagttcagcagtttgcacttcctggtcctcgactactgcaagtaaggctgaagcagaactctgaaggctgtgcagagatggtgacagccagaggagggagggggaggggaggaccacacccgggttctctgtgcctctagccttcctcctgtacccaagtaaatgctagtgttcccttttgttctttcaaacaagtgtcttagggtttctagtgctgcaccactgggtctcgcataaattcactgtactggctggttttatggcaacttgatacaagttagagttatcagagaggaggaggctcaactgagaaaattcctccataaaaTTTTTCTGTAGGAGCTGGGATTAAAGGTGTGCACGACCCCACCGCCCAGCTCCTATAGCTGAATCTATGGAGGAATTTTCTCAATCGAGGCT
This mutation is a 940 bp deletion beginning at Chromosome 9 position 96,517,356 bp and ending after 96,518,295 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50621 | TTG GCA GCA AAA ATG TTG AG | Wild type Forward | A | |||
| 50622 | CAG AAA CAA AGC CTG CAA GA | Wild type Reverse | A | |||
| 50623 | ATC TCT CCA ACC CCT GGA CT | Mutant Forward | A | |||
| 50624 | AGA AAA TTC CTC CAT AGA TTC AGC | Mutant Reverse | A | |||
| 50625 | Fluorophore-1 | TGG GAA CAC ATG GGA ACT CA | Quencher-1 | WT Probe | ||
| 52318 | Fluorophore-2 | CTG GGA TTA AAG GTG TGC ACG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50621 | 0.40 uM |
| 50622 | 0.40 uM |
| 50623 | 0.40 uM |
| 50624 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.