For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:21593727+21593821 95bp CCAGTACAGATGCCAATAGGG TCCTTCATCCTCCACATCAAC
Mut = 105 bp
Wt = 95 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTCTCAGATAACCAACAACTAGTATGGACATGACTGGACTTGAAGCTGAGACTTCTCTGGGCTTTGTAATGTCTGCAGTCGGCTTTCCCTAAAGCCTCATGCAAACATGGCTGATACTCCGGGGTTTACAACAcactgcggcaggggaggggcgggacttccagggcggaattttcggtgacatcaccacagaaagttcgttaaagcaagggctttggctgcgttctggaagtagggcccgaggtctgtcggtggggtggcttctgcagcgtgtggccgtgtgaccccacggaggtgacctcccaggtgagtcctccgcgtccctcggtggtgatcagtgtgtcgtcctgagatgtagtgtcgtggatacccagtgtgccctcttctctcgtctcttccacagagcggctgaggttgagaacccattgagcagctaggccccagtgtatgcgctgatcctatggcggaggcccgtgggaaccaaggcgagagctgtgtgagcctggaggacgtgtgcctgcgtttcactgcagaggagtggggtctcctcgatgacactcagaagctcctgtaccacaacgtgatgctggagaatttcttgcttgtgctgtccctgggacttccgatttccaaatccttcccaggtaccccagcgatagatgctgtcttagtcagggtttctattcctgcacaaacatcatgaccaagaagcagttggggaggaaagggtttattcagcttacccttcaatactttctctgtgataactccagctgtgtcaagttgacacaaacccagccagtacagatgccaatagggactccctgttaaccaaagcatgatggcgtaggtaatctaagctcgcTCCCGAGGTTGATGTGGAGGATGAAGGATGTGAGCAGAGCATCTTCAACAAATGCTTCACACCCTGAAGCTTAGCTCTGTAAGAGTGTTAGGCATCAAATAAAAAATTTAACCAGTTATCCAGCCTGGAGAACCCAC
This mutation is a 732 bp deletion beginning at Chromosome 10 position 21,593,062 bp and ending after 21,593,793 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50572 | TCC TTC ATC CTC CAC ATC AAC | Common | A | |||
| 50573 | CCA GTA CAG ATG CCA ATA GGG | Wild type Forward | A | |||
| 50574 | CTG GGC TTT GTA ATG TCT GC | Mutant Forward | A | |||
| 50575 | Fluorophore-1 | TCC CTG TTA ACC AAA GCA TGA TG | Quencher-1 | WT Probe | ||
| 52220 | Fluorophore-2 | CTT TCC CTA AAG CCT CAT GCA AAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50572 | 0.40 uM |
| 50573 | 0.40 uM |
| 50574 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.