For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:77408144+77408235 92bp ACTTACCAAAACCGAACACG GAAAAATCCATTCCCAGGAC
Mut = 90 bp
Wt = 92 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ATTTAGGTCTCCCAACTTTTGACTCTCTTGCCTTGGTGGCATGCTATGAGATGctggcttaaaggggggaaaaaagggttaaatgatttaaaatttctctaatttttttgtttctttgttatctgttaacctcaggctgtaagactggaaagtacttaccaaaaccgaacacgctatatggtcgtggtttcaactaatggtagacaagacactgaagaaagcattgtcctgggaatggatttttcttctaatgacaggtatgataccataaaaaatggggaaggggcatgaaaactactttttaagagaactacttttaaaataacctgttacagttattaaagctattgcaaaagtgtcttgtataattaagcttttaaaattcaagataaagTAGGGCTAGAAGGTAAGAGGATGAGGTTTGTGCGTTTGTGTTTTATCTTTTTGAGACAAGATCTCTCTGATGTAGACCAGGCTGACCTTGAACTCAGAAATCAGCCC
This mutation is a 341 bp deletion beginning at Chromosome 11 position 77,408,044 bp and ending after 77,408,384 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52082 | ACT TAC CAA AAC CGA ACA CG | Wild type Forward | A | |||
| 52083 | GAA AAA TCC ATT CCC AGG AC | Wild type Reverse | A | |||
| 52084 | CCC AAC TTT TGA CTC TCT TGC | Mutant Forward | A | |||
| 52085 | GAT AAA ACA CAA ACG CAC AAA CCT C | Mutant Reverse | A | |||
| 52086 | Fluorophore-1 | ATG GTC GTG GTT TCA ACT AAT GG | Quencher-1 | WT Probe | ||
| 52087 | Fluorophore-2 | TGG TGG CAT GCT ATG AGA TGT AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52082 | 0.40 uM |
| 52083 | 0.40 uM |
| 52084 | 0.40 uM |
| 52085 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.