For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:65390272-65390429 158bp TGTATCCACGTTGGTCTATGC AAGCTCACAACTCTGGCAGT
Mut = 164 bp
Wt = 158 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGTATTTATAACCCCCAGGGAAGTTTTTTTTTCCCCTCCCCGCCCCGGGGTAGCCCCAGAGTCAGTGGCCCCTGGCAAATCTAGGCCCCCCAGCGGCAGCAGCCTCCACCCCTCTGGCTCATCATGCCCCCAGGCCccgaggtcccagtgcaggtgtgggtggacggtcaactcttccaggcggagcagtcgctgctggtggagcactgcggcttcttccgcgggcttttccgctctggcatgcgggaggcgcgcgccgcggaggtgcgcctgggcgcgctgagcgcctccggcttccgcacggcgctgcgggtgctgcgcggagagcggccggcgctggcggccgaggacgagttgctgcaggcggtggagtgcgccgcgttcctgcaggcgcccgcgctcgcgcgcttcctggagcacagcgtcacgtcggacaactgctcgcttttgtgcgacgcggccgccgccttcggcctgcgcgacgtgctccacagcgctgcgctcttcatccgcgacgggtcgcacgagctggtggcacaactggagctgcccgaggcccgagcctacgtggcggcgctgcgacccagcacctacgtggcggtgagcacgcacacgcccacaccgggcttcctagaggatgcgtcgcgcaccatgtgcttcctggacgaggaagaggacgcatggcgcacgctggccgcgctgcccctggaggccagcacactgctggcgggtgtggccaccctgggcaacaagctctacatcgtgggtggcgtgtgtggtgccagcaaggaagtagtggagctaggcttctgttacgacccagagggtggcacctggtgcgaattccccagccctcaccaaccgcgctatgatatggcgctggctggcttcgaaggccgcctctatgccattggtggcgaattccagaggacacccatgagctccgtggagtgctatgatcccgccacaggttgctggagcttcgtggcggacttgccacagccggctacaggggttccctgtgcccaggcacgtggccgcctcttcgtgtgcctgtggaggccggcagacatcactgccgttgtcgagtatgtggtgcaaatggacaagtggctgccagtggctgaactgtgtcgttcacagagctacggtcactttatggtggcccatcgcgatagtctctatgtagtacgaaatggaccttccgatgatttcctgcactgtgccatcgattgcctcaacctggtcacaggccagtggacatcgctacctggccaatttgtcaacagcaagggagcactcttcacgtctgtagtgcgtggggacaccgtttatactgtcaaccgtgtatccacgttggtctatgccattgaagatggcacctggcggctgctcagggaaaaggctggctttcctcggcctggctctttacagacctttcttctgcggctgcctcctggcactactggacctgtgGCCACCGCACTGCCAGAGTTGTGAGCTTGGAATGACTTCAGAAGATAACACAAGTCTCCATGAACCTTGGCGGTGTCCTCATGAGCCTTGACTGTGTGATTGGGGAGCTCTTGGGAACTCCTTTTTCCCTATTA
This mutation is a 1340 bp deletion beginning at Chromosome 9 position 65,390,300 bp and ending after 65,391,639 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50922 | AAG CTC ACA ACT CTG GCA GT | Common | A | |||
| 50923 | TGT ATC CAC GTT GGT CTA TGC | Wild type Forward | A | |||
| 50924 | GGT ATT TAT AAC CCC CAG GGA AG | Mutant Forward | A | |||
| 50925 | Fluorophore-1 | CTC AGG GAA AAG GCT GGC TTT | Quencher-1 | WT Probe | ||
| 51949 | Fluorophore-2 | CCC CTG GCA AAT CTA GGC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50922 | 0.40 uM |
| 50923 | 0.40 uM |
| 50924 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.