For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:27462409-27462503 95bp GATGCCTCAGGAGGAAGTTG GCCTTCTTTTACCTGCATTTTG
Mut = 100 bp
Wt = 95 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GCGTGTGCCACCACGCCTGGCGTAAAGACTGTTTTTATGCTTTGCATTCTTCTCAGATTTTCCACGTTGAAAAATAATCTTGTcctccctccatgacaaatctcttaacaaatatagtgctttcttgaactataacctacagtgttgttttttgcaagtgcacaactcctttcccagtgagtgacctgggttctctgtcttcagcccacagatgatatagtgctaatggcccaggccttagagaaaatctttctgcagaaagtggcccagatgcctcaggaggaagttgaactattgccccctgctccaaagggcaaaggccggaagccagctgcaggagcccaaaatgcaggtaaaagaaggcaggcagggagggagggagcacaggctttccctgctgaggctgtgggactcctttgatccctctaagtttttACTGTTGCCTGACAGGTAGGACAGGTGTCATGAGCTTGGCTGGTGATGGATCCTTAGCTG
This mutation is a 352 bp deletion beginning at Chromosome 2 position 27,462,338 bp and ending after 27,462,689 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51878 | GAT GCC TCA GGA GGA AGT TG | Wild type Forward | A | |||
| 51879 | GCC TTC TTT TAC CTG CAT TTT G | Wild type Reverse | A | |||
| 51880 | GCA TTC TTC TCA GAT TTT CCA C | Mutant Forward | A | |||
| 51881 | CAG CTA AGG ATC CAT CAC CA | Mutant Reverse | A | |||
| 51882 | Fluorophore-1 | CCC CCT GCT CCA AAG G | Quencher-1 | WT Probe | ||
| 51883 | Fluorophore-2 | CTT GTA CTG TTG CCT GAC AGG TAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51878 | 0.40 uM |
| 51879 | 0.40 uM |
| 51880 | 0.40 uM |
| 51881 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.