For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:54468178-54468260 83bp GGGACTAATGGGGTGGTAGA ACCTCAACCAACCTGTCCTG
Mut = 81 bp
Wt = 83 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGCCCTGGTGACGAGTGGCTAGGGACTAATGGGGTGGTAGAGCCcctagggtggagaggaaggctttatttgaaaatgatagcgcaggacaggttggttgaggtggtggtggaaaaagaaagaagggaggccaggaagggccaatgtcaaagctcagagaggttcatgggggggggggggagggggtgttgtagttttggaaaaagaattagatttctgttttgaattatccagatctttgctggtttcaaggcaccactgtttggataaaagtggcatctggattctgttcttttaaggtcaaagaaaacaactaccggggccacggagatagtgtggaccagctttgttggcacccaagcaaccctgacctctttgtcaccgcatctggagataaaaccattcgcatctgggatgtgaggactacaaaatgcatcgccactgtgaatacgaaaggtgagttcagagagagggggttctggaggaaaagctagtgtgatctgcagcaagcatctttgtagcaagtgcaggttatcaggatgggttgtatgtgtctgtctggagaagacaggaacagaacagagcacttttctggcaggctgtagatgtataggagagcagtggaaactatacaagagtagtatgtgcagaggcgtggagagtttgggagattcaggcaggttacaatggctgagaaaccatggGCGATCTGGAAAGTTGTGCGTTTTGTTTAAAGGCTGTGTTCAAAGAAGCAGTGTGGTAGTTTGAGTAGGCTTGGCCCAGGGCATGGCA
This mutation is a 660 bp deletion beginning at Chromosome 13 position 54,467,578 bp and ending after 54,468,237 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51844 | GGG ACT AAT GGG GTG GTA GA | Common | A | |||
| 51845 | ACC TCA ACC AAC CTG TCC TG | Wild type Reverse | A | |||
| 51846 | TAC CAC ACT GCT TCT TTG AAC A | Mutant Reverse | A | |||
| 51847 | Fluorophore-1 | AGG GTG GAG AGG AAG GCT TTA | Quencher-1 | WT Probe | ||
| 51848 | Fluorophore-2 | CCG CGA TCT GGA AAG TTG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51844 | 0.40 uM |
| 51845 | 0.40 uM |
| 51846 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.