For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:99219394-99219500 107bp GTTCTGTCCCGACATCCTGT GAAAGTCAAAGGGGCTGGT
Mut = 156 bp
Wt = 107 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TAAGTACAGTAAAAATATTGATCATAGTTAATACATATGTGTTTGGTAGTATGACAAATTAACTACCTTGAATTGACTTGAACAGTTAGAGACTTAGAGTTCATTTAATTCTCTACGAGTGTGAGCAGTGATTAGtggtgcccttagcttaatcagtttcaaatatttatgagcaactgacagtggtgagtaagatccagtgggataaggagggcatggggtaagccagctgttggcagttttgaaacaggctgattgctacaaaggagtttgatactgtcttctttgctttttcttgtatttaaacgtttccatattagagtgtttttaaatgactatatacttaggcactaatattgaattttcaactattgactttttaaggtctgggaccaagtaaaggcttccaaccctgacctaaagttgtgggagattggcaagattattggtggcatgtggcgagatctcactgatgaagagaagcaagaatatttaaacgaatacgaagcagaaaaggtaggaggactgccttggcttattatttataaaagaaaccaagcgtgaccagatggctgagccacactgcagttttgtccaccaagcttcactcatctgagtggcacattctttgttctgtcccgacatcctgttttacctctccctctgatgttcagagggacagtgcaggtggcctgtggagtagaatggacattataaaaccagcccctttgactttcagatagagtacaatgagtctatgaaggcctaccataattcccctgcgtaccttgcctatattaatgcaaaaagtcgtgcggaagctgcattagaggaagaaagtcgacagagacagtctcgcatggagaaaggagaaccttacatgagcattcagcctgctgaggatccagacggtaaggtggaaaacggggctttgtatatgtattctctctgaattagaaaagaaatttagttcaaggcatttttattcttttaaatggaaaagcataattttaagtctttttgttgtagtaagattttaagtagtaagatttttgcgtgtgactttctcatggaaaaaatactccttacagggtGGAAAATTATCAAAGAAAAAAAGCTGTATTTATTACTTATCAAAGTCTTTATACTCAGAATAGAGGATTTGTTTGATTTTCGAGACAGGGCCTCACTGTGTTGCCCA
This mutation is a 955 bp deletion beginning at Chromosome 11 position 99,219,039 bp and ending after 99,219,993 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50050 | GTT CTG TCC CGA CAT CCT GT | Wild type Forward | A | |||
| 50051 | GAA AGT CAA AGG GGC TGG T | Wild type Reverse | A | |||
| 50053 | GTC TCG AAA ATC AAA CAA ATC C | Mutant Reverse | A | |||
| 50054 | Fluorophore-1 | AGT GCA GGT GGC CTG TGG | Quencher-1 | WT Probe | ||
| 51669 | CCT TGA ATT GAC TTG AAC AGT TAG | Mutant Forward | A | |||
| 51670 | Fluorophore-2 | AGT TCA TTT AAT TCT CTA CGA GTG TGA GCA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50050 | 0.40 uM |
| 50051 | 0.40 uM |
| 50053 | 0.40 uM |
| 51669 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.