For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:63143523-63143642 120bp AGGTAGCTCTCAGGAAGTGAGC GTGGATTTGGGATAATCTTTGG
Mut = 128 bp
Wt = 120 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGGTAGCTCTCAGGAAGTGAGCATAGAACGTgggggtggctttggacagccgctggcttgaaagcggctttgtgttttaagtaatttgttccggagtaccaaagattatcccaaatccactacggtacgtcatcactgcgttcaggtctccagggcccaccaacctctgccacactctcgtccttcctgttggcccgctgggcaagggtgtcccgcctaatcgcctgtcattttcggccgtcgcaggtgtatgcgcctgaaagggacgaacacgtgaagagtacggcggtggcggcggcgctggggcccgcggcctcttacctctgcaccccagagacccacggtaatgcctcctgaggtctctggcccttttaatGCAGGAAGTACAGAGAGAACCCAGAGCCAAGGCAGGCCTTTCAAGGAAGGGAGGGGCGGAAAGAGACGGAGAGAAA
This mutation is a 345 bp deletion beginning at Chromosome 9 position 63,143,267 bp and ending after 63,143,611 bp (GRCm38/mm10). There is a 2 bp insertion (AC) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51574 | AGG TAG CTC TCA GGA AGT GAG C | Common | A | |||
| 51575 | GTG GAT TTG GGA TAA TCT TTG G | Wild type Reverse | A | |||
| 51576 | CCC TTT CTC TAT CAC CCC TTT TC | Mutant Reverse | A | |||
| 51577 | Fluorophore-1 | CTG GCT TGA AAG CGG CTT T | Quencher-1 | WT Probe | ||
| 51578 | Fluorophore-2 | TAC GCA GGA AGT ACA GAG AGA ACC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51574 | 0.40 uM |
| 51575 | 0.40 uM |
| 51576 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.