For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:163086742-163086845 104bp CAGCCACACGCAGAAAATG GCAACATAGTTTCCTTAGTTAGGC
Mut = 113 bp
Wt = 104 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACAAGTCTTTCTCCGACTTCTAAGTGTACCCCCAATGTCACTCCTTACAAATAAACACATGATGTAAAAAAGATGTTTTTAAAAGACCACACAACCGAcgctgatgaataaggggtttgattatgctaatgaagcccgaaactgccaagggccgggtacgtgtcataactacatttgaacagcagctttcctcaagccacttcccccacccagtggacagtctgtccctgatgtcataagctgcccattgtgaccacctgttctgtcctttgacaacacagggtatcttagcgtcaaagcatcattataacctgctaacttcacctccttggaagctactgtttcgggctcttgtacctgcctgagttaacgtctctggtggctgttttctggctttctctgcatagcgattgctgacagaacgtgagtgagaatttcactccagagacccaagagccaaagcctggcagaagacagcacaatctttcacaggaagaggcttttcctttcgaggtgtaccacgtacactttgggcagcaggacacttggcttcaagtcaactcccggatggagccagaatccatagaaatttgtccttataaccctcaccaccgaatcccgctcagcaggttccagtaccacctggcgtcatgcaggaagaagaaccccaagaaagccaaaaagatggccagctgtaaatacaacgcctgccacgtggttcccatcagaaagctggctgaacatgaagctacctgtgtcaacaggagctccgtggaggaagaggacacattaggccctctgcaagtcagcctcccacagccgcagaaccaggacacactacaggttcgttggctttccaaccctgacatttggaatgttgacggcgccaactgtcacccaatgttcgtccttaagagttttgttccccaaaaacttgtttgtgaaagtgacatccaagagtcacggggaggagaccaatgcccagaagatcctcagactaggaccaggaaggcaaacttctagcaggaggaagagggctctcaaatgcgtggatggatcgcgcatctcatctgaataaaaacctgcaaagtaacggtccgggctgtgctggttgtttttaaaggtttagaaagagcggtggaggtggggtttagaactgagctgagaatgtaaattgaaccaccttccatggggaacacttaacagtcgctatgaaaatgctcactcaacgcacacaggctttgatcaagtcattcgacatctaaaacagcatcccgcacagccagccacacgcagaaaatggggttgagtaaaaagttactcccgtgttatttatagcagcactgaggtaccCATAGGGAAGGCCTAACTAAGGAAACTATGTTGCAACTTTACAAAGGAGAGA
This mutation is a 1255 bp deletion beginning at Chromosome 2 position 163,086,776 bp and ending after 163,088,030 bp (GRCm38/mm10). There is a 3 bp insertion (TTA) 5 bp after the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51525 | GCA ACA TAG TTT CCT TAG TTA GGC | Common | A | |||
| 51526 | CAG CCA CAC GCA GAA AAT G | Wild type Forward | A | |||
| 51527 | AGT GTA CCC CCA ATG TCA CTC | Mutant Forward | A | |||
| 51528 | Fluorophore-1 | ACT CCC GTG TTA TTT ATA GCA GCA | Quencher-1 | WT Probe | ||
| 51529 | Fluorophore-2 | AAA AGA CCA CAC AAC CGA CAT AGT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51525 | 0.40 uM |
| 51526 | 0.40 uM |
| 51527 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.