For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:112504549-112504656 108bp CTTCCTGAACCTCCTGGTCA CCCTTCTCAGTGATGGTGTCA
Mut = 102 bp
Wt = 108 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGAGTTCTTGACTTGGCCCTGGTTCCCCGGTACATCAGTGGTGGCAAGTCCCCAACTCCCAGTCTGCGAGAGAACAAGATGGCAGCTCAACATCGGAACatttgcagggatggcagcagaggagatggaagcagccctctgagccccattccatcccatcagggccccaggtgctcaccagaaaacctggacatcccccctcctgtttcaaggggagctatttggggtcagaccttgagtggctccttcagcatccatctcttgactccactgcagctccttcttctacgccttcctgaacctcctggtcagtgcctttgtggtcttcctggtcttcattgccagcaccatcgtgagtgtgggcttcaccatgtggtgtgacaccatcactgagaagggctccacaccccacaggtatgcctcacccctgcttcatcagccacctacaagacccacctttacctgggtccctatgtttttcttcctgaatctgaggctttgcccacctgtgccccacccctacacctgttgccttttccctaagacccacccacctgcgccccacccccgcacctgttgccatgcccctaagacccgcccacctgcgccccccccacacctgttgccatgcccctaagacccgcccactcaatgtcaggcacctctttggtctagtagccctacagcattacacatggaaggtccctgtgggccgagaggcaccagatgggatcctgcagttgacaccgcctggcacacttgctagccttagctcgctctgaagctaactccactgtgtcgccatgatgttagtttgtggttggtgagtggagattgccctcatggtgtccctgtgacacttatgcagggacacagtgcaatgtgcctcagggggcatcacatccatctcagactgggaactgcaggactgactagacagagcagctcatgaccccgagtgccggacagacagtgacaagatagtgctccgggccagtcgtaaaggtctgcagctcctcttctttgaagcctgtcttgctccacccagtgaggggccaaagctgaccccgagtggagttcctagaggcatctgtccctttgggtactggcccctctgtcttagggttttgactgctgcaatggaacaccccggccaacgcgtcttggggaggaaagggtttattcagcttacacttcaatatcacagttcctcatcaaagaaagtcaagacatgaacacagcagggcagggacctggaggcaggacctgaggcagaagccactggaggggtgctgcttactggcttgctcctctagatctgctcagccaggggtggccacgcccacaatgggtggggctatttcccaccaatcactaagtaagaaaatgtcttacaggcttgtctgcagcctggaagcattttctcaattgaggttcctgcctctcgactttagcttgtatcaggttgatctaagacgccactcagtggttaggggaagtattctctgcatcctagctctgctgccttttgacttgggggctcaggggctcggggcctggggggctcgggggcttgggggctcaggggctcacaagtcaccagccacttggcttcgtgctattttagctgcgaggagttccaggaaacggacttggagctgaacgtcgacaactctgccttctaccatcagtttgctatcgcccaggtaggcggggtctcgggcaggtaggcggggtctgtctctggccggaagggaatggctctgttggggtgaggggtgagacctcgacagatagaacagactcccggatcccagataaggaaacagactcagatacggtggggccatgCCGGGGAGGTGCAGGCTGTGGAGCAAGAGATTTCCTAGGAGAGGTTAGGAGAGTGGGGTCTCTGAGCAAGACTTGTGTCAGGGGTTGGGAGATAGGGGAGTCAGCAAAGGCAGAC
This mutation is a 1752 bp deletion beginning at Chromosome 12 position 112,503,097 bp and ending after 112,504,848 bp (GRCm38/mm10). There is a 3 bp insertion (CTA) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48467 | AGA GAA CAA GAT GGC AGC TCA | Mutant Forward | A | |||
| 48470 | TGC TCA GAG ACC CCA CTC TC | Mutant Reverse | A | |||
| 51461 | CTT CCT GAA CCT CCT GGT CA | Wild type Forward | A | |||
| 51462 | CCC TTC TCA GTG ATG GTG TCA | Wild type Reverse | A | |||
| 51463 | Fluorophore-1 | CCT GGT CTT CAT TGC CAG C | Quencher-1 | WT Probe | ||
| 51464 | Fluorophore-2 | AAC CTA CCG GGG AGG TGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48467 | 0.40 uM |
| 48470 | 0.40 uM |
| 51461 | 0.40 uM |
| 51462 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.