For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:68031913+68032035 123bp GAAGGGAGACAAAGCCAGAA AATCCAGAGAGCCTGGTGCT
Mut = 150 bp
Wt = 123 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCACAGGAGGGCTACCATCTCTGGAATTCAGCTCTGCCGTTGCTGTGGCAAGGGGGATGAACTGACAGCAGATCCATAATGGTGTAAACTGGTTCATGTGGGTGGAGGTGACCATGctaagaagggagacaaagccagaaagtgacaggccacggaaagtccggtttcgaattgcctcatctcacagtgggagagttctgaaagaggtctatgaagatggacaagcaccaggctctctggattctgaatgtgctagtatttgtgccatagatgggctaagtgactctgagggacagcaaaacggccacattggatcagaggataatgaacaggagaaagatcaggataacctgctggtattagccaggacagccagcgagaaggcttttggcacaagaagagtcaacattttaagcaaaaatggtacagtcagaggcgtcaagtacaaagtgagtgctggccaggctctgtttaacaatttgaccaaagtgttgCAGGTAAGTCATTATACACTTTCCTGTTCTGCGCTCTTCTCCTCACCCACCATCTCCACCCCTTTCAGTTCTCCAGGATGGAGTCAACGTCTCCTTCCTCCA
This mutation is a 378 bp deletion beginning at Chromosome 5 position 68,031,909 bp and ending after 68,032,286 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49112 | CAC AGG AGG GCT ACC ATC TC | Mutant Forward | A | |||
| 51437 | GAA GGG AGA CAA AGC CAG AA | Wild type Forward | A | |||
| 51438 | AAT CCA GAG AGC CTG GTG CT | Wild type Reverse | A | |||
| 51439 | AGC GCA GAA CAG GAA AGT GT | Mutant Reverse | A | |||
| 51440 | Fluorophore-1 | TCC GGT TTC GAA TTG CCT C | Quencher-1 | WT Probe | ||
| 51441 | Fluorophore-2 | CAG CTC TGC CGT TGC TGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49112 | 0.40 uM |
| 51437 | 0.40 uM |
| 51438 | 0.40 uM |
| 51439 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.