For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:92198517+92198632 116bp CCTCGAGCTACAAACCCAGA AGAGTGGCTGTTGGCAGGA
Mut = 120 bp
Wt = 116 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGAAGCTATAGCTACAGGTTAGCAAGGGCCTGTTACCATTTAGTTTGCTTTTGTGAGCTATGATTCTTCATCTTCAAAAAAAAAATGCTACTTGTACAATGTATCTGCGGGTCAATTATTTAAGCCAAGTTATTCAgttatgtctccgggcaaccacaacattcttccatgttccttcttccctgactgagggcactgaatagtgaaaacggggaaaatgcgccaaaatgagagacatcaatcaaggtcaaaactgacacctaaatcaaattaaaaagaaaaagaaaagaaaaaagaatgaaagaaaaagaaaaagaaagaaaggaaggattatgtaaaatcaaaagcaacctaaactttaaatatccaacaagatatttatcttctcttgcagattcccagaaccaaaaccctagaagtctgcctgggtttcttcctcgagctacaaacccagatcaaaactctcaggaggcttcttccaatcccaggaaacaggcaaggcagcagccgggtgtctctcagccaagcagtttcctgccaacagccactctccctcctggtctagagtatttaagccaggtttgcatgacttcactttctactagagtgttttctttaaaagagcggtttcttgtttttcaaccaataatttaatggaatacaaaaatgcatgaaaatcatgaagttataaaagactgattttattgacttctattatttagaaagacttaatccactttattgccacctatccttatttacttgacagagtctcaagactaaacagtcTTGACTTTGTCATGCAACACGTTTATCTGCCTCTGCTCATGGCTCAAGGTGTTAAGATAGATATTCTCAAGGAATTATCAGACGAAACCACATACAGCTATTAATTAAGCATATTTATTGAACACTTGCTATATTCAAGGCTCGTAAGAAGCATAGCGCCTATCCCTTGTCACTCAAACATTTTGTAAGTTAATGATCAAACAAACAAACAAA
This mutation is a 953 bp deletion beginning at Chromosome 9 position 92,198,268 bp and ending after 92,198,820 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49628 | CCT CGA GCT ACA AAC CCA GA | Wild type Forward | A | |||
| 49629 | AGA GTG GCT GTT GGC AGG A | Wild type Reverse | A | |||
| 49630 | TTG TGA GCT ATG ATT CTT CAT CTT C | Mutant Forward | A | |||
| 49631 | AGA GGC AGA TAA ACG TGT TGC | Mutant Reverse | A | |||
| 49632 | Fluorophore-1 | CCA GGA AAC AGG CAA GGC A | Quencher-1 | WT Probe | ||
| 51386 | Fluorophore-2 | CTA CTT GTA CAA TGT ATC TGC GGG TCA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49628 | 0.40 uM |
| 49629 | 0.40 uM |
| 49630 | 0.40 uM |
| 49631 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.