For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:23874590+23874719 130bp CAGTTCCAGGGTTCTGTTCC GGTGACCCTGTGTTGTTCAC
Mut = 150 bp
Wt = 130 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACTATCTTGAGGAAAAAAATTTCTCAGTGTGCAACTGTCAACCAGAGTAGTTATATCAGTTTGAAGATGAAAGTATTTTCTTTGAGAGAAAGGgacttacttccaaagggaacccaaggtattcatcaaggatccattcaaaatagacccacacccaaacatttggaactgaattaactttctgggacattctaattggaacaatttcttaaagtaataaattattaaatcaatatcgcattttcccattaaatgataatttctagaaggatgttctgcaacaaaattttaacttactatctagtatatctagggttgcaaatacctgaatttttacttcaactgtgttgctaattgagattttctttttcaacttctcagttccagggttctgttccttccggtatggactggctatccttctgcacttctgtaacattgccatcatggcccagagagtgtgcctgaacctcaccatggtagccatggtgaacaacacagggtcaccccatttatctaacgaatctgtagtggagatgttggacaatgtaaaggtatagtgaaagtgtaaagtgcaagtttaaaacttaaactcgtgagctaggttctacagagGTCAGTTATTATTGGCAAGATAATAGGAATAATTAGAAAATGAAGCTTAAGTTTAAATGTGGACGACAGCACTCACTAGACTGGAGTCTCAGAATGAACAAAAAGAAAACAGG
This mutation is a 522 bp deletion beginning at Chromosome 13 position 23,874,305 bp and ending after 23,874,826 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51356 | CAG TTC CAG GGT TCT GTT CC | Wild type Forward | A | |||
| 51357 | GGT GAC CCT GTG TTG TTC AC | Wild type Reverse | A | |||
| 51358 | TGT GCA ACT GTC AAC CAG AGT | Mutant Forward | A | |||
| 51359 | CCA GTC TAG TGA GTG CTG TCG TC | Mutant Reverse | A | |||
| 51360 | Fluorophore-1 | CCA TCA TGG CCC AGA GAG T | Quencher-1 | WT Probe | ||
| 51361 | Fluorophore-2 | AAG GGT CAG TTA TTA TTG GCA AGA TAA TAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51356 | 0.40 uM |
| 51357 | 0.40 uM |
| 51358 | 0.40 uM |
| 51359 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.