For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:87825430-87825537 108bp GAGCAGGCTTGTGTGTCAGA TAACCTCGATTTCCTGGGACT
Mut = 115 bp
Wt = 108 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CATTTTTTTAAGCTTACTTTTTTGTGGTGCTGGGAATCGAGCCAGGGCTACTTGCATGCTAGACAAACACTACTGAGCCACATCTCTCTAGGGTCACTTTTAAgggttttgaaaacagtgcacaaatgttcttctatatagagtgtttttcatgtgtgaccttattatctcaaattgtattgtgaacaaaagagcaggcttgtgtgtcagatctattcttcctctttctttcccaacaagaaagttggccccaagatgctggatcatgaaggtaaagaagtcccaggaaatcgaggttacaagtactttggggcagcaaaagatttgcctggtgtcagagagctatttgagaaagaacgtaagtagttcatgtgtttgagagtgcgttggcctttaattgttgctactgagtgagagaagtatgctgtatgctatctggtaggaattattgctcccagattttaaaaaatagtttaaaatttgtattcctaagtttattctatatttttgtagcatggtctcatgtacccccagGCTTTGAATGCCTCATCTTCTTATATCCACCTGTTAGGAATATAGACATCTATCCTTTTTGTTAAAAAACAAAAAACAAAAAACAAAAAAACCATTGTTCACGCTGGCCTAAGACTTGCCAACTAACTTCTGTCTCAGCCTTCATAG
This mutation is a 431 bp deletion beginning at Chromosome 6 position 87,825,195 bp and ending after 87,825,625 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51347 | GAG CAG GCT TGT GTG TCA GA | Wild type Forward | A | |||
| 51348 | TAA CCT CGA TTT CCT GGG ACT | Wild type Reverse | A | |||
| 51349 | GAG CCA GGG CTA CTT GCA T | Mutant Forward | A | |||
| 51350 | GAT GTC TAT ATT CCT AAC AGG TGG A | Mutant Reverse | A | |||
| 51351 | Fluorophore-1 | AGT TGG CCC CAA GAT GCT | Quencher-1 | WT Probe | ||
| 51352 | Fluorophore-2 | CCA CAT CTC TCT AGG GTC ACT TTT AAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51347 | 0.40 uM |
| 51348 | 0.40 uM |
| 51349 | 0.40 uM |
| 51350 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.