For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:124583670+124583782 113bp TTCTTTGCCATGGGTTTAGG GGCAGTCTGGTGTCAAGTAGC
Mut = 119 bp
Wt = 113 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CATGTGGCCCCACCATGTGTATATGATAGGTAAGGTTCTAATCTGTAAATGACTCTGTCTGTGAGGGGAAGAAGgtctcctctcagcttctttgccatgggtttaggaaaagaaaagctgagcagatttttagcagggaatccttgtcagatgtcattgagcatctgacaggactcgctgctacttgacaccagactgcctggggccacgtagcaagaccctttcttacacacaccacagtgtataataagtaaataatgctaagtaatagctactttttctttcaacgactcctccctcgaggctgatggggttgtgtgggagctgacatgttcctctcgtgtctgtcagtttactttatccaaatgcatggatgcagtgatggtgctggcgaattctcacctgttcatgaaccgctccaaccagctggctgtcatcgccagtcacattcaggaaaggtaggggccagaggctgcttttcagtcctttaacagttgcatgcatgggtagagcaccttccggttactcagaggatctttctcctccccctcagccggctcttatacccggggaagaacggtggacttggagacttcttcggagaccctggcaatgcgctccccgactgtaacccctctgggagtaaagatgggaaatacgagctgttgacagttgcaaacgaggtgatcgctgaggagatcaaggatctgatgaccaagagtaagagcctggctattgtcactgctgtctccatgtggtgggaattggtGTATGTTTTTAAAGTGCAAGATTCTTATGAATTCTTTAAGAATTTCATACATGTATGCCTTGTGTTTTGATGATATTCACCAATCCCATTCTTCTCCCTAACCCCAGATCCACTTTCATCTCCTCCCTACATCTCCTCTCCTCCCTACATCTCCT
This mutation is a 695 bp deletion beginning at Chromosome 5 position 124,583,657 bp and ending after 124,584,351 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51208 | TTC TTT GCC ATG GGT TTA GG | Wild type Forward | A | |||
| 51209 | GGC AGT CTG GTG TCA AGT AGC | Wild type Reverse | A | |||
| 51210 | CTC TGT CTG TGA GGG GAA GA | Mutant Forward | A | |||
| 51211 | GGA GAA GAA TGG GAT TGG TG | Mutant Reverse | A | |||
| 51212 | Fluorophore-1 | CAG GGA ATC CTT GTC AGA TGT CA | Quencher-1 | WT Probe | ||
| 51213 | Fluorophore-2 | CAT ACA TGT ATG CCT TGT GTT TTG ATG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 51208 | 0.50 uM |
| 51209 | 0.50 uM |
| 51210 | 0.50 uM |
| 51211 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.