For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:106709641+106709784 144bp TTTTATGAGGCCACAGTGCT GGGGCCATTATATCTCACAGG
Mut = 143 bp
Wt = 144 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACAAAACTATATTTCAAGTGCTTCTCGTTGTTTTGCATGCAATCTTATATCATTTTTTTCTTCTCTACTTTACTCCAGGAATCCTGCCCAACTTCACATTTTAAAAAATCGAGACCATAtgaaagacctccgcaggtacctgatgttcaaatacatccagtatctagtcctgccttctccgaatgtcatcatcattctgctgggatctcttgccagtctctatgtcatgctgctattgacatttccttccgtttccagaaaatccactgcggtgtttattggtagcatagctcaggcagacatcttagttgtctgcagcttgttttctgctatctcagcatgcgtgataaggagcgagccatcgtcaacttcttttcaactagccttgaggcaaaacttccaaattgcaaatatccatgccagttcccttttactcagctgtgttacccttgaggcttttctgattacttttcttccagtagagacacgccacataaggaatgttagatgtgccagagtggcttctaaaatcatctgggctgttgtaattaccgagtgtttcctttatcagcttgaatatgtcaaaggccttaacatctcctatcttggcattcataggcaaattcagctattgatgaatttcttttatgaggccacagtgctgctgaaattacttatttatcccattggagttcttctaagaatcttcaacgtatatcttttttataaaatgtatttccgagaccatTATAGTTAGTTTCTCAGGCCTGTGAGATATAATGGCCCCGTTGTTTTGTCAAACAGTCATATTTATGGGGCTATGAAGACATTTTATAGCTGTGGTT
This mutation is a 629 bp deletion beginning at Chromosome X position 106,709,117 bp and ending after 106,709,745 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51149 | GGG GCC ATT ATA TCT CAC AGG | Common | A | |||
| 51150 | TTT TAT GAG GCC ACA GTG CT | Wild type Forward | A | |||
| 51151 | AAG TGC TTC TCG TTG TTT TGC | Mutant Forward | A | |||
| 51152 | Fluorophore-1 | CCC ATT GGA GTT CTT CTA AGA ATC TTC | Quencher-1 | WT Probe | ||
| 51153 | Fluorophore-2 | CTT TAC TCC AGG AAT CCT GCC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51149 | 0.40 uM |
| 51150 | 0.40 uM |
| 51151 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.